CI01000001_10989337_10992917 (BIRC5B)


Basic Information

Item Value
gene id CI01000001_10989337_10992917
gene name BIRC5B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 10989337 ~ 10992978 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000001_10989337_10992917.mRNA
AAATGTCTAACGCAGAAGTGATTGCGTCCCGTCTCTTGTCGTTTAATCAGATGTATAGTTATGAAAAGCGTCTTCAGACTTTTTCCGAGTGGCCTTTTCGAGAAGATTGCCAGTGCACACCAGAGCTGATGGCCAAGGCAGGTTTTGTGCACTGTCCTAGTGAGAACGAGCCAGACGTGGCCTGCTGTTTCTACTGTCTCAGAGAGCTGGAGGGCTGGGAGCCAGAAGACAACCCCTGGTCTGAGCATGCCAAACGCTCCCCCAATTGTGGCTTTCTCCATATGAAAAAGACGTTTGATGATCTCACGGCCATTGAGTATTTTCAGCTGGAACAGGAGCGACTTCGCATTTATATTAGGAAGATTGGTCACAGGAAGATAGCCTACTTTCGTGATGAGGTGGAGGCCACAAGCAAAAATCTTAGAGCTCTAATTTGATATACAGTGATGCTAAATTATTTTAATGACATGCTTTATTTGAACTTTTTATATTTCACCA

Function

symbol description
birc5b Predicted to enable cysteine-type endopeptidase inhibitor activity involved in apoptotic process. Acts upstream of or within several processes, including circulatory system development; nuclear division; and regulation of apoptotic process. Predicted to be active in cytoplasm; nucleus; and spindle microtubule. Is expressed in several structures, including axial blood vessel; caudal vein plexus; intermediate cell mass of mesoderm; nervous system; and unfertilized egg. Human ortholog(s) of this gene implicated in prostate cancer and transitional cell carcinoma. Orthologous to human BIRC5 (baculoviral IAP repeat containing 5) and BIRC7 (baculoviral IAP repeat containing 7).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K08731 BIRC5; baculoviral IAP repeat-containing protein 5

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000001_10989337_10992917.mRNA True 498 mRNA 0.45 4 10989337 10992978

Neighbor

gene id symbol gene type direction distance location
CI01000001_10968536_10981345 NA coding upstream 7550 10968344 ~ 10981787 (+)
CI01000001_10856786_10861403 C1GALT1A coding upstream 127199 10855960 ~ 10862138 (+)
CI01000001_10807407_10818870 SLC26A10 coding upstream 169284 10807320 ~ 10820053 (+)
CI01000001_10749174_10779222 ARHGEF25A coding upstream 209883 10749174 ~ 10779454 (+)
CI01000001_10715529_10716091 NA coding upstream 272427 10715114 ~ 10716910 (+)
CI01000001_11019871_11028065 MYL6, MYL6B coding downstream 26501 11019479 ~ 11028524 (+)
CI01000001_11099313_11137500 HUWE1 coding downstream 106335 11099313 ~ 11138278 (+)
CI01000001_11138617_11139541 NA coding downstream 145307 11138285 ~ 11139673 (+)
CI01000001_11182552_11204143 NADL1.2 coding downstream 189574 11182552 ~ 11204499 (+)
CI01000001_11216246_11230227 SMC1A, SMC1A.L, SMC1AB, SMC1AL coding downstream 223268 11216246 ~ 11230321 (+)
G19130 NA non-coding upstream 2871 10925528 ~ 10986466 (+)
G19034 NA non-coding upstream 92432 10892437 ~ 10896905 (+)
G19088 NA non-coding upstream 114466 10874670 ~ 10874871 (+)
G19087 NA non-coding upstream 115104 10873982 ~ 10874233 (+)
G19080 NA non-coding upstream 173635 10814390 ~ 10815702 (+)
G19121 NA non-coding downstream 77926 11070904 ~ 11126159 (+)
G19226 NA non-coding downstream 176315 11169293 ~ 11183770 (+)
G19096 NA non-coding downstream 262091 11255069 ~ 11304024 (+)
G19108 NA non-coding downstream 388596 11381574 ~ 11381987 (+)
G19258 NA non-coding downstream 394665 11387643 ~ 11387959 (+)
G19039 NA other upstream 135354 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 449491 10538388 ~ 10539846 (+)
G18937 NA other upstream 512948 10474984 ~ 10476389 (+)
CI01000001_10395420_10396473 NA other upstream 592632 10394851 ~ 10396705 (+)
G18872 NA other upstream 707968 10271146 ~ 10281369 (+)
G19314 NA other downstream 508216 11501194 ~ 11558673 (+)
G19395 NA other downstream 688344 11681322 ~ 11681817 (+)
CI01000001_13514115_13517063 NA other downstream 2520426 13514115 ~ 13517063 (+)

Expression


Co-expression Network