G13009



Basic Information


Item Value
gene id G13009
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 829368 ~ 829618 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU14450
ATTTAATGCTTCTTTGCTGAATCAAAGTATTAATTTAAAAAGAAGTTGCCAAATACAACTTTTACTTAACATTTGGCACTTGGCAAATGTTAATTATGGTTTCTGCTAACCGGTGAGACATTATACACCCAGTTTGAGGCCATTTGAAGTAATTTCATTGGCCTTCAATATGACTAACAAATTCTAATGTTAAAGAATCTGGATATCCAAACAAGTTTTAGTCCTCAGAAGGGCTAAAGCCAGAACCGTGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU14450 True 251 lncRNA 0.34 1 829368 829618

Neighbor


gene id symbol gene type direction distance location
CI01000001_00808831_00814314 SALL4 coding downstream 14727 807938 ~ 814641 (-)
CI01000001_00754687_00806154 ATP9A coding downstream 22826 754565 ~ 806542 (-)
CI01000001_00716122_00741331 NA coding downstream 87748 716103 ~ 741620 (-)
CI01000001_00636063_00642086 KCNG1 coding downstream 186989 636042 ~ 642379 (-)
CI01000001_00580789_00602408 SRC coding downstream 226740 579076 ~ 602628 (-)
CI01000001_00839822_00841040 NA coding upstream 10012 839630 ~ 842421 (-)
CI01000001_00872245_00878013 ZFP64 coding upstream 41262 870806 ~ 878013 (-)
CI01000001_00925612_00928679 NA coding upstream 95822 925440 ~ 928949 (-)
CI01000001_01030701_01030988 NA coding upstream 200636 1030254 ~ 1031164 (-)
CI01000001_01033836_01034518 NA coding upstream 203718 1033336 ~ 1034920 (-)
G12999 NA non-coding downstream 8780 820389 ~ 820588 (-)
G12997 NA non-coding downstream 11241 817787 ~ 818127 (-)
G12907 NA non-coding downstream 118052 614220 ~ 711316 (-)
G12963 NA non-coding downstream 222784 605101 ~ 606584 (-)
CI01000001_00538192_00559082 MICAL1 non-coding downstream 275616 537593 ~ 559082 (-)
G13236 NA non-coding upstream 30621 860239 ~ 860528 (-)
G13262 NA non-coding upstream 86630 916248 ~ 916447 (-)
G13264 NA non-coding upstream 89621 919239 ~ 919520 (-)
G13265 NA non-coding upstream 91297 920915 ~ 921145 (-)
CI01000001_00362143_00378213 NA other downstream 432235 361614 ~ 378213 (-)
CI01000001_00238241_00249437 NA other downstream 571851 238241 ~ 249437 (-)
CI01000001_00124107_00131285 ELOVL4B other downstream 694443 122814 ~ 131380 (-)
G14104 NA other upstream 934051 1763669 ~ 1771468 (-)
G14219 NA other upstream 1164592 1994210 ~ 1994898 (-)
G14228 NA other upstream 1226356 2055974 ~ 2056478 (-)
CI01000001_02258523_02262621 NA other upstream 1429771 2258442 ~ 2263103 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other upstream 3562696 4392314 ~ 4399804 (-)

Expression



Co-expression Network