G150234 (tmprss9,LOC107704409,LOC107731339,LOC107593090,LOC107695615,LOC107586983)


Basic Information

Item Value
gene id G150234
gene name tmprss9,LOC107704409,LOC107731339,LOC107593090,LOC107695615,LOC107586983
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056720.1
NCBI id CM032089.1
chromosome length 18002998
location 5854785 ~ 5855167 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU222349
TCTCGTCAGCCTCATTGGGGCAGTCAATGACTCTGTCACACTCTGGGTTTGTCTTGCTGATGCACATGTTTCCACCACAGTTATAATTTCCACTGCAGTTCCCAGGAGATGAGTAATAATCATTACTGACTTGTTCAGAGGATGGGCTCATAACTTGGGCAATGTGAACTGTAGTGTTTGTGACACTAGGTACAGTGGAGGCGACTGGGATTGTTGGTGCAGTGTTGGTGTAGCTCAGAATCCAGTTGCGGAGCTTGGTAACGCGGGAATAGACTCCAGGCTTGTTTATCTGCGCGCATCCCACTCCCCAGCTCACCACGCCAGCTAAGAAAAAGCGTCCAGGTGACGTCTCGCATACAAGAGGGCCTCCAGAATCTCCCTGA

Function

symbol description
tmprss9 Predicted to enable serine-type endopeptidase activity. Predicted to act upstream of or within proteolysis. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human TMPRSS9 (transmembrane serine protease 9).

NR:

description
PREDICTED: transmembrane protease serine 9-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU222349 True 383 lncRNA 0.50 1 5854785 5855167

Neighbor

gene id symbol gene type direction distance location
sass6 sass6,LOC107756018,LOC107695611,LOC107731314 coding downstream 7855 5839748 ~ 5846930 (-)
LOC122327539 NA coding downstream 61731 5789815 ~ 5793054 (-)
bap1 bap1,LOC107704441,LOC107695622,LOC107755981 coding downstream 82712 5764038 ~ 5772073 (-)
LOC122327508 NA coding downstream 97607 5754395 ~ 5757178 (-)
shisa10.1 LOC107695620,LOC107756007 coding downstream 103703 5745190 ~ 5751082 (-)
arhgef18b arhgef18,LOC107695632,LOC107593089,LOC107586933,LOC107755984,LOC107704429 coding upstream 27659 5882826 ~ 5922490 (-)
insrb insrb,LOC107695633,LOC107586934,LOC107704428,LOC107593049 coding upstream 72349 5927516 ~ 5984443 (-)
atp6ap2 atp6ap2,LOC107663666,LOC107745967 coding upstream 156268 6011435 ~ 6016809 (-)
LOC122328173 LOC107708183,LOC107753648,LOC107696926,LOC103909885 coding upstream 240943 6096110 ~ 6097823 (-)
mid1ip1b mid1ip1b,LOC107756028,LOC107663600,LOC107704421,LOC107593044,LOC107745972,LOC107586944 coding upstream 330802 6185969 ~ 6187727 (-)
G150233 NA non-coding downstream 382 5854201 ~ 5854403 (-)
G150232 NA non-coding downstream 2895 5851285 ~ 5851890 (-)
G150152 NA non-coding downstream 30872 5822929 ~ 5823913 (-)
G150126 wu:fb55g09,LOC107587000,LOC107755988,LOC107704455,LOC107720989,LOC107658378,LOC107593068 non-coding downstream 199409 5654051 ~ 5655376 (-)
G150184 NA non-coding downstream 250367 5604157 ~ 5604418 (-)
G150271 NA non-coding upstream 289711 6144878 ~ 6155016 (-)
G150273 NA non-coding upstream 302330 6157497 ~ 6183901 (-)
LOC122327580 NA non-coding upstream 458008 6313175 ~ 6314227 (-)
G150216 krt97,krt96,LOC107663680,LOC107745983,LOC107593038,LOC107739339,LOC107580444 non-coding upstream 488972 6344139 ~ 6345150 (-)
G150322 NA non-coding upstream 522520 6377687 ~ 6381972 (-)
LOC122327537 NA other downstream 90803 5758006 ~ 5763982 (-)
nol8 LOC107586918 other downstream 181976 5661741 ~ 5672809 (-)
nisch nisch,LOC107586977,LOC107593071,LOC107653160,LOC107755997 other downstream 202626 5638138 ~ 5652159 (-)
bloc1s1 bloc1s1,LOC107573571,LOC107653169,LOC107745401,LOC107658402,LOC107720994,LOC107586997 other downstream 312705 5538556 ~ 5542080 (-)
gls2b gls2b,LOC107658399,LOC107745412,LOC107653170,LOC108431573,LOC106566158,LOC105007068 other downstream 321976 5527230 ~ 5532809 (-)
timm13 timm13,LOC107587003,LOC107731338,LOC106573564,LOC107593051 other upstream 4180 5859347 ~ 5861332 (-)
use1 use1,LOC107756022,LOC107745970,LOC107593088 other upstream 134330 5989497 ~ 5992758 (-)
G150276 npb,LOC107587005,LOC107663585,LOC107756033,LOC107704419,LOC107593099 other upstream 381085 6236252 ~ 6236865 (-)
gcga gcga,LOC107755995,LOC107663711,LOC107593098,LOC107704412,LOC107586984 other upstream 427289 6282456 ~ 6285580 (-)
G150440 r3hdm1,LOC107739334 other upstream 660398 6515565 ~ 6659352 (-)

Expression


Co-expression Network