G14917


Basic Information

Item Value
gene id G14917
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 3851831 ~ 3852048 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU16683
CGGTCTTTAGCGTCCTTGCTAGTGCGCTCACCTCCCATGCCGGAAACGCTGGTTCGAATCCCGCTCGGAGTGTTACCAATAGAACCGGAGGGTTAGCCGTGACCCGGATGGGAGTGAGGTTTAGAGGGCTGAGTGTAACGACTCACATGCTGTGTGAGTAAACCACACTCCCCTGGCCTCAAGAGGTGTGCTAGCGACTGACGCTAGAGGTTGCGGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU16683 True 218 lncRNA 0.57 1 3851831 3852048

Neighbor

gene id symbol gene type direction distance location
CI01000001_03830254_03833027 NA coding upstream 18804 3830254 ~ 3833027 (+)
CI01000001_03821989_03823336 SLC48A1A coding upstream 28247 3821989 ~ 3823584 (+)
CI01000001_03719251_03775929 ITGA5 coding upstream 75406 3718190 ~ 3776425 (+)
CI01000001_03669438_03673748 CSRNP2 coding upstream 178044 3668725 ~ 3673787 (+)
CI01000001_03650790_03662852 LSF, TFCP2, TFCP2.L coding upstream 188887 3650636 ~ 3662944 (+)
CI01000001_03865986_03866675 NA coding downstream 13309 3865357 ~ 3867469 (+)
CI01000001_03867875_03890850 NA coding downstream 15792 3867840 ~ 3890989 (+)
CI01000001_03983212_04011240 NA coding downstream 131080 3983128 ~ 4011596 (+)
CI01000001_04085864_04225894 PLXNA2 coding downstream 233816 4085864 ~ 4225894 (+)
CI01000001_04296723_04300348 NA coding downstream 444553 4296601 ~ 4300975 (+)
G14912 NA non-coding upstream 6990 3844469 ~ 3844841 (+)
G14911 NA non-coding upstream 10477 3841143 ~ 3841354 (+)
G14874 NA non-coding upstream 156439 3636855 ~ 3695392 (+)
G14878 NA non-coding upstream 167363 3683322 ~ 3684468 (+)
G14873 NA non-coding upstream 218248 3633093 ~ 3633583 (+)
G14931 NA non-coding downstream 26471 3878519 ~ 3878797 (+)
G15202 NA non-coding downstream 82524 3934572 ~ 3934835 (+)
G15208 NA non-coding downstream 86611 3938659 ~ 3939680 (+)
G15225 NA non-coding downstream 100324 3952372 ~ 3952917 (+)
CI01000001_03618075_03620436 NA other upstream 230380 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 2180827 1667762 ~ 1671167 (+)
G13051 NA other upstream 2806679 1043713 ~ 1045152 (+)
CI01000001_00483853_00488761 VWA1 other upstream 3359774 483853 ~ 488825 (+)
G12614 NA other upstream 3540890 309144 ~ 310941 (+)
G15794 NA other downstream 1209170 5061218 ~ 5064704 (+)
CI01000001_05279884_05287123 NA other downstream 1434701 5279837 ~ 5287698 (+)
G15995 NA other downstream 1859837 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 3680524 7531541 ~ 7540586 (+)
G17234 NA other downstream 4180076 8032124 ~ 8032483 (+)

Expression


Co-expression Network