LOC122328187 (ncan,ncanb,LOC107728538,LOC107554802,LOC107687726,LOC107599474,LOC107719650)


Basic Information

Item Value
gene id LOC122328187
gene name ncan,ncanb,LOC107728538,LOC107554802,LOC107687726,LOC107599474,LOC107719650
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056720.1
NCBI id CM032089.1
chromosome length 18002998
location 9686468 ~ 9689140 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043223896.1
GAGAACCCGACGAGATGTTCGATGTGTACTGCTTTGCCAATGGCCTGCAAGGTGAAGTGTTTCACACCAGCGTGCCAGAGAAGTTGAGCCTGGCGTCTGCCTCCACTCACTGCCACACTCTGGGAGCTCAACTGGCCACAGCCGGGCAACTCTATCTGGCCTGGCAGGGTGGCCTGGACCGCTGTGACCCCGGCTGGCTGGCTGACGGCAGCGTGCGTTACCCCATCAACCTTCCCCGGCGTAACTGTGGAGGAGATGAACCAGGAGTACGGACTGTTTACCATAACCCCAACCGCACCGGGTTTCCAGACACTAGCGACCTCTTTAGCGCCTACTGCTATCAAGAGAAGAATTTTGAAGAGCAGACGGCAATACTCTATAAAACCCTAGAAAACTCCAATTCGAGCTCTTCAAGCAATGAAGAGGTGCTGCTTCAAAGAAATGGAGCCTACCCTGAGCCTTCAACTTGGACCGGTCTGGTCGATCTTGAGAAAGAAGACTTCAAGTCCATCATAAACAATGAATCTTCAGAAATTTCAGAGGAGCATGTTGTAATCCATCTTGGACCTGAAGAAAAGTCTGAAGAGTGGGAAGACGATGCTGTGGAGAAGCAGGAGAACCTTCAAGGGGGTTCAGCAAAAGAGGAGACAGATGATTCCGATGTGTCTCCTGACCCGTCTTCAACCACGCCATCCTCCTCTACGCAAGCTCAGACCAGCAACAGCGTCATCTCCAACTTTGTCAACACAATCATGAAACCGTTTAGGTACTGGACAGGGACTAGAGAACCTGAGATACCGGCCACAGAGTCCAGCCTTTACAGAGGAACATCAGAAATGGTCCCACCTGCCAGGACCAAGCCAAGTAGAGGGAAAACAAGCAAAGTTGGTGTTGATAATGCTATCATGGAGCCTAATACCAAGGAACATTCATATAATCCCTCCTCGTCAGATCCAGAAGAAGAGCTCTTGGAGCAGGAGAAGGAAGTGGGCTTGGTGGATGCGCAGAAGGAGATAAAGAGTCAAAGCAATTCTTACATGGATCATGCATATTTACAGACCTTCACTGGACCAAACAAAGGTACAACACACTCGTCCAAAGCTTAA

Function

symbol description
ncanb Predicted to enable calcium ion binding activity; carbohydrate binding activity; and hyaluronic acid binding activity. Predicted to be involved in central nervous system development and skeletal system development. Predicted to act upstream of or within cell adhesion. Predicted to be located in extracellular region. Predicted to be active in extracellular matrix. Orthologous to human NCAN (neurocan).
ncan Predicted to enable calcium ion binding activity; carbohydrate binding activity; and hyaluronic acid binding activity. Predicted to be involved in central nervous system development and skeletal system development. Predicted to act upstream of or within regulation of synapse structural plasticity. Predicted to be located in Golgi lumen; extracellular region; and lysosomal lumen. Predicted to be active in extracellular matrix and synapse.

NR:

description
PREDICTED: neurocan core protein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043223896.1 True 1106 mRNA 0.50 3 9686468 9689140

Neighbor

gene id symbol gene type direction distance location
LOC122328186 ncan,LOC107687726,LOC107719650,LOC107599474,LOC107728538 coding downstream 3877 9625685 ~ 9682591 (-)
si:ch73-63e15.2 si:ch73-63e15.2,LOC107669818,LOC107592676,LOC107599449,LOC107655177 coding downstream 88962 9555171 ~ 9597506 (-)
tjp3 tjp3,LOC107669831,LOC107719622,LOC107592677,LOC107655241,LOC107728571,LOC107599473 coding downstream 137461 9533382 ~ 9549007 (-)
arhgap45b hmha1b,LOC107669820,LOC107655244,LOC107592722 coding downstream 154336 9506588 ~ 9532132 (-)
pip5k1ca pip5k1ca,LOC107592679,LOC107719627,LOC107599447,LOC107655246 coding downstream 189005 9473013 ~ 9497463 (-)
LOC122328188 ncan,ncanb,LOC107728538,LOC107687726,LOC107554802,LOC107719650,LOC107599474,LOC107097932 coding upstream 41501 9730641 ~ 9788375 (-)
rfxank rfxank,LOC107687741,LOC107554808,LOC107728547,LOC107719616,LOC107599486 coding upstream 197033 9886173 ~ 9887859 (-)
tmem221 NA coding upstream 201410 9890550 ~ 9894967 (-)
tmem161a tmem161a,LOC107728546,LOC107599454,LOC107719614,LOC107554814,LOC107687722 coding upstream 224283 9913423 ~ 9918916 (-)
tssk6 tssk6,LOC107687737,LOC107728539,LOC107554804,LOC107599475,LOC107719648 coding upstream 305052 9994192 ~ 9995007 (-)
G151319 hapln4,LOC107554801,LOC107728536,LOC107719665,LOC107599484 non-coding downstream 65303 9616790 ~ 9621165 (-)
G151289 NA non-coding downstream 221955 9426153 ~ 9464513 (-)
G151266 NA non-coding downstream 232121 9360531 ~ 9454347 (-)
G151280 NA non-coding downstream 288372 9387145 ~ 9398096 (-)
G151122 NA non-coding downstream 539167 9145305 ~ 9147301 (-)
LOC122327858 NA non-coding upstream 130553 9819693 ~ 9865888 (-)
G151444 NA non-coding upstream 334078 10023218 ~ 10028439 (-)
G151439 NA non-coding upstream 364778 10053918 ~ 10072892 (-)
G151468 LOC107687734,LOC107728578,LOC107719602,LOC107655224,LOC107569929 non-coding upstream 500690 10189830 ~ 10194857 (-)
G151457 NA non-coding upstream 555778 10244918 ~ 10249842 (-)
gpx4a gpx4a,LOC108429535 other downstream 183462 9498669 ~ 9503006 (-)
nfia nfia,LOC107592693,LOC107599440,LOC107653654 other downstream 514537 9013548 ~ 9171931 (-)
G151107 tal1,LOC107669848 other downstream 799527 8884121 ~ 8886941 (-)
zbtb37 zbtb37,LOC107588063,LOC107757486,LOC107653628,LOC107669814,LOC107715095,LOC107592718,LOC107592717,LOC107669813,LOC107715094,LOC107757485,LOC107588062,LOC107653629 other downstream 1073724 8600350 ~ 8612744 (-)
tmem264 tmem264,LOC107715063,LOC107757465,LOC107665501,LOC107653574,LOC107588123,LOC107561895 other downstream 1393260 8286372 ~ 8293208 (-)
G151425 NA other upstream 268671 9957811 ~ 9983147 (-)
polrmt LOC107687709,LOC107728563,LOC107569934,LOC107655172,LOC107719647,LOC107569035,LOC101483880 other upstream 592882 10282022 ~ 10321663 (-)
micos13 si:dkey-78l4.14,LOC107596903,LOC107719663,LOC107586453,LOC107675912,LOC107655188 other upstream 729987 10419127 ~ 10422354 (-)
oaz1a oaz1a,oaz1s,oaz1,LOC107719576,LOC107655198,LOC107586434 other upstream 1245912 10935052 ~ 10994952 (-)
rex1bd si:ch211-87h14.3,clg08h19orf60,cssa23h19orf60,LOC107676986,LOC107729673,LOC107593355,LOC107719569,LOC108439285,LOC103025814 other upstream 1485003 11174143 ~ 11188692 (-)

Expression


Co-expression Network