G15404


Basic Information

Item Value
gene id G15404
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 4566270 ~ 4566542 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17225
GTTTTCCTGGAAAAAGAAGTTTTTAAATTGTACTTTTTTGTCATTTTTTTAGAAGTACAATAATGTATTGATGCCTTCAAAGCTAATAGACATAGGCAAAAGGTCACAGAAATTTATTAAATGGAGTTGAGCTGTCCAGAAATTTCAGAAATTTCCTCTTTTTTACTATGACACCCAATTGTTTGTACTTTCAGCGCACTGAATGTGTATCTGTATGTTGTGTCTGATTCAGTAACATGGCACTTGGAAGTTACACAAACACACTCAGCCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17225 True 273 lncRNA 0.34 1 4566270 4566542

Neighbor

gene id symbol gene type direction distance location
CI01000001_04543164_04553053 COMMD7 coding upstream 12597 4542618 ~ 4553673 (+)
CI01000001_04462781_04463560 NA coding upstream 101657 4462781 ~ 4464613 (+)
CI01000001_04433559_04437385 NA coding upstream 128820 4433559 ~ 4437450 (+)
CI01000001_04422037_04431229 NA coding upstream 134138 4422037 ~ 4432602 (+)
CI01000001_04369131_04373697 SNPHB, SNPH coding upstream 192298 4369131 ~ 4373972 (+)
CI01000001_04567822_04568927 NA coding downstream 922 4567464 ~ 4569260 (+)
CI01000001_04586080_04595939 NA coding downstream 19354 4585896 ~ 4596418 (+)
CI01000001_04624476_04679572 NOL4LB coding downstream 57934 4624476 ~ 4679829 (+)
CI01000001_04688934_04700615 HCK, SRMS coding downstream 122392 4688934 ~ 4700704 (+)
CI01000001_04701645_04713999 NA coding downstream 135103 4701645 ~ 4714153 (+)
G15371 NA non-coding upstream 74889 4486920 ~ 4491381 (+)
G15370 NA non-coding upstream 79471 4481838 ~ 4486799 (+)
G15360 NA non-coding upstream 209654 4356216 ~ 4356616 (+)
G15338 NA non-coding upstream 217689 4343888 ~ 4348581 (+)
G15389 NA non-coding downstream 32135 4598677 ~ 4726740 (+)
CI01000001_04723418_04724292 NA non-coding downstream 154133 4723354 ~ 4725671 (+)
G15395 NA non-coding downstream 187175 4753717 ~ 4758419 (+)
G15416 NA non-coding downstream 230934 4797476 ~ 4797794 (+)
G15419 NA non-coding downstream 234431 4800973 ~ 4801530 (+)
CI01000001_03618075_03620436 NA other upstream 944819 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 2895266 1667762 ~ 1671167 (+)
G13051 NA other upstream 3521118 1043713 ~ 1045152 (+)
CI01000001_00483853_00488761 VWA1 other upstream 4074213 483853 ~ 488825 (+)
G12614 NA other upstream 4255329 309144 ~ 310941 (+)
G15794 NA other downstream 494676 5061218 ~ 5064704 (+)
CI01000001_05279884_05287123 NA other downstream 720207 5279837 ~ 5287698 (+)
G15995 NA other downstream 1145343 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 2966030 7531541 ~ 7540586 (+)
G17234 NA other downstream 3465582 8032124 ~ 8032483 (+)

Expression


Co-expression Network