G156698 (asb14b,LOC107671999,LOC107560887,LOC107737718,LOC108276494)


Basic Information

Item Value
gene id G156698
gene name asb14b,LOC107671999,LOC107560887,LOC107737718,LOC108276494
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056721.1
NCBI id CM032090.1
chromosome length 19062720
location 11653380 ~ 11654160 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU232064
CATCTTTGATGACAGAAACGCTCCAGCCCTCATAATCCACGGGCACATGCGAGGCCTGTCCATACGGGCAGTCAAAGCAGCGCTGCACATCGTAGCCGTTATTGAGCAGCATACGCAGCATCACCTCGTCCTTAAGAGCGTACTGAAGGGCGGAAGGGAAGTGGGTGGTGTTGACACGGGAGTAGTAGTTCACATTGGCACCGTAGCGGAGAAGAGTGTTGATCAGCTCGTAGTTGCCCAATCGCATGGCCACCTGCAGGCAGCTGACAGGGTCTTGATTGGCCATGGCCCCGGCCTCCAGAAGCAGCCTCGCTGACTGGACGTCGTTGTTGGATACGGCGAAGAACAGCGCTGACCTGCGCTCGTCTTCATAGTTCCTGCGCACTCTGGGGTGCAGCATGAAGTTTGCGTCAAACCCGGAGCTCAGGAGCAGATCCAGACACTGAGAGTGACCTCCTGCAGCGGAGGAGTGTAACGGGCTCATGCCGCTGTCTTTGATCGCCTCTTTCTTAGTCGCAGGGATCAGCTGCTCCAGGACTCTGTGAAAGACAGTTTTTTAGGGTAAACGCTATGTTGATTAACCCATCAGCAGGGTGGTACTCACAGCAGATGTCCGCGGTAGGCTGCGCGGTGGATGGGGAGATGGCCGGTGTGGGTGGGAACGTTGGGGTCGGCTCCATACTCCAGCAGCAGTGAAATGATATCGGGGTTTCCAGAAGCCGCAGCATCAAATAAAACTGAGGCTGAACCGAGAGATTGTGGCTTGGACCACACACTGGCC

Function

symbol description
asb14b Predicted to be involved in protein ubiquitination. Predicted to act upstream of or within intracellular signal transduction. Orthologous to human ASB14 (ankyrin repeat and SOCS box containing 14).

NR:

description
PREDICTED: all-trans-retinol 13,14-reductase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU232064 True 781 lncRNA 0.56 1 11653380 11654160

Neighbor

gene id symbol gene type direction distance location
LOC122328536 LOC107737719,LOC107671965,LOC107560886,LOC107656999,LOC107570275,LOC107712682,LOC101883217 coding upstream 15357 11634276 ~ 11638023 (+)
apobec2b apobec2b,LOC107737624,LOC107560928,LOC107672022,LOC107657013,LOC107712740 coding upstream 123719 11527406 ~ 11529661 (+)
si:dkey-109j17.5 si:dkey-109j17.5,LOC107672024,LOC107737623,LOC107560927,LOC107562462,LOC107657015,LOC107712743 coding upstream 128512 11520750 ~ 11524868 (+)
ccdc115 LOC107560885,LOC107737721,LOC107672061,LOC107657017,LOC107562463,LOC107712745 coding upstream 132775 11518832 ~ 11520605 (+)
trnae-uuc_33 NA coding upstream 134844 11518465 ~ 11518536 (+)
atp6ap1lb atp6ap1lb,LOC107672058,LOC107737620,LOC107560932,LOC107570286,LOC103031199,LOC108436292,LOC107699574,LOC105890636 coding downstream 31552 11685712 ~ 11693491 (+)
slmapb slmapb,LOC107560933,LOC107712736,LOC107699575 coding downstream 41656 11695816 ~ 11704390 (+)
flnb LOC107737717,LOC107560870,LOC107671935 coding downstream 51599 11705759 ~ 11722286 (+)
abhd6b abhd6b,LOC107737716,LOC107712730,LOC107560889,LOC107671974,LOC107699577 coding downstream 68996 11723156 ~ 11726492 (+)
dnase1l1 dnase1l3,LOC107737612,LOC107672041,LOC107560934,LOC107570280,LOC107712731 coding downstream 84635 11738795 ~ 11741871 (+)
G156690 fam208ab,LOC107737622,LOC107712737,LOC107570279 non-coding upstream 2273 11614130 ~ 11651107 (+)
G156685 NA non-coding upstream 97461 11540640 ~ 11555919 (+)
G156684 NA non-coding upstream 113065 11539615 ~ 11540315 (+)
G156682 NA non-coding upstream 118463 11534590 ~ 11534917 (+)
G156681 NA non-coding upstream 120182 11532635 ~ 11533198 (+)
G156699 asb14b,LOC107560887,LOC107671999,LOC107737718 non-coding downstream 95 11654255 ~ 11654617 (+)
G156700 NA non-coding downstream 756 11654916 ~ 11655316 (+)
G156701 NA non-coding downstream 1635 11655795 ~ 11656380 (+)
G156828 NA non-coding downstream 80096 11734256 ~ 11734937 (+)
G156823 LOC107560942,LOC107737604,LOC107712727,LOC107672007 non-coding downstream 109547 11763707 ~ 11822844 (+)
G156586 NA other upstream 476347 11174421 ~ 11177033 (+)
LOC122328437 LOC107737657,LOC107560901,LOC107671993,LOC108435244,LOC108275530 other upstream 567776 11077154 ~ 11085604 (+)
G156497 trim101,LOC107671958,LOC107560876,LOC107719918,LOC107656995,LOC107747989 other upstream 729392 10913904 ~ 10923988 (+)
G156414 LOC107707743,LOC107747988,LOC107671949,LOC107559475 other upstream 952485 10698798 ~ 10700895 (+)
G156399 LOC107707753,LOC107672006,LOC107603149 other upstream 1081134 10563344 ~ 10572246 (+)
kctd6b kctd6b,rpl10,rl10,LOC107671957,LOC107570288,LOC107737715,LOC107560935,LOC108436290,LOC103399204,LOC107672042 other downstream 43254 11697414 ~ 11746570 (+)
LOC122328549 smim4,LOC107560937,LOC107671967,LOC107737614,LOC107712735,LOC107699582,LOC107570283 other downstream 76820 11730980 ~ 11732361 (+)
LOC122328708 LOC107737579,LOC107672049,LOC107565833,LOC107712694,LOC107687392,LOC566587,LOC107593419 other downstream 592033 12246193 ~ 12251982 (+)
c1qtnf12 fam132a,LOC107591142,LOC107716139,LOC107593919,LOC107687484 other downstream 2439918 14094078 ~ 14126201 (+)
si:dkey-151g10.3 LOC107737519,LOC107716153,LOC107593909,LOC107668334,LOC107673054 other downstream 2645541 14299701 ~ 14343274 (+)

Expression


Co-expression Network