G157446 (epha2b,epha2,LOC107737541,LOC107591085,LOC107716125,LOC107687430,LOC107593930,LOC102306962,LOC102194419)


Basic Information

Item Value
gene id G157446
gene name epha2b,epha2,LOC107737541,LOC107591085,LOC107716125,LOC107687430,LOC107593930,LOC102306962,LOC102194419
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056721.1
NCBI id CM032090.1
chromosome length 19062720
location 13938443 ~ 13939354 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU233151
CCGAGGGTCAAAATCTGCAATGGCCTTCAGAGAATCAGGGCTCTTGAGGAGCTTGTCTAGTATGCTGACAATGTCGCCAAAGCGGGGCCGTTTGGAGCGATCTTGCAGCCAGCACTGTAACATCAGCTGATAGACGGCAGAGGGGCAGTCCATTGGAGCAGGAAGGCGGAAAGCCTCATTAATGGCCTTCATTACCTAGAGAGACAAAAGTAGTCAGATAAGACGGAAGATCCTTTGGGACTAACAGCAGAGTTATTGTTCATAGCCGATGTGGTACCTCATGGTTACTCATGTCCCAGTAGGGCCTCTCTCCAAAGGCCATGACCTCCCACATGACAATGCCAAAACTCCACACATCACTTGCTGACGTGAATTTCCTGTAAGCTATGGCCTCCGGAGCAGTCCAGCGAATAGGAATTTACGTACGCTGGTGGTGTAGGTTCCTTCAGGGTCGTCCTCCAAAACACGTGACAAACCGAAGTCAGACACCTTGCACTCCAGGTTGCTGTTGACCAAGATGTTTCTGGCAGCCAGATCCCTGTGTACATAGCTCATGTCTGAGAGATATTTCATCCCGGCCGCAATGCCACGGAGCATACCGACCAACTGGAAGGATGACATCTCGCCATCGTGGTCCTGTGAAGAACAGTTTTAAATCGAATTTGTTCTTGTGAAAGGAAATCCACACTAGGGAGTTCCTGAGTAAGTTATTAGCTATGTTAAATCACTTTGAAGGTATGTCAGTTTCATCTGTCA

Function

symbol description
epha2b Predicted to enable ATP binding activity and ephrin receptor activity. Predicted to act upstream of or within protein phosphorylation and transmembrane receptor protein tyrosine kinase signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of plasma membrane. Is expressed in shield and somite. Human ortholog(s) of this gene implicated in cataract 6 multiple types. Orthologous to human EPHA2 (EPH receptor A2).
epha2 Enables growth factor binding activity and transmembrane receptor protein tyrosine kinase activity. Involved in several processes, including activation of GTPase activity; intracellular signal transduction; and regulation of intracellular signal transduction. Located in several cellular components, including focal adhesion; lamellipodium; and tight junction. Is integral component of plasma membrane. Implicated in cataract 6 multiple types.

NR:

description
ephrin type-A receptor 2 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU233151 True 756 lncRNA 0.49 2 13938443 13939354

Neighbor

gene id symbol gene type direction distance location
clcnk clcnk,LOC107737667,LOC107716123,LOC107687482,LOC107593941 coding upstream 26693 13905088 ~ 13911750 (+)
LOC122328345 LOC107591092,LOC107673087,LOC107737549,LOC107716117,LOC101883939,LOC107593944 coding upstream 106998 13824959 ~ 13831445 (+)
ttll10 LOC107591093,LOC107716116,LOC107593935,LOC107687423 coding upstream 113906 13804114 ~ 13824537 (+)
ptpn11b ptpn11b,LOC107591094,LOC107737552,LOC107593936,LOC107673095,LOC107687422,LOC107716115 coding upstream 159769 13751746 ~ 13778674 (+)
agrn agrn,LOC107591095,LOC107673061,LOC107593945,LOC107737670,LOC107716114 coding upstream 191271 13538953 ~ 13747172 (+)
szrd1 szrd1,LOC107673108,LOC107716129,LOC107687433,LOC107737539,LOC107591082 coding downstream 68866 14008220 ~ 14012879 (+)
mlh3 LOC107673081,LOC107591079,LOC107737666,LOC107687437 coding downstream 105429 14044783 ~ 14050528 (+)
kansl2 kansl2,LOC107687436,LOC107716132,LOC107737532,LOC107591080,LOC107673082,LOC107593923 coding downstream 111337 14050691 ~ 14056567 (+)
LOC122329331 NA coding downstream 115010 14054364 ~ 14054500 (+)
LOC122329330 NA coding downstream 117331 14056685 ~ 14056821 (+)
G157459 NA non-coding upstream 37351 13897831 ~ 13901092 (+)
G157417 NA non-coding upstream 55484 13801420 ~ 13882959 (+)
G157423 LOC106566923 non-coding upstream 76237 13858965 ~ 13862206 (+)
G157408 her9,LOC107716081,LOC107593950,LOC107687478,LOC107737700,LOC107703052 non-coding upstream 443067 13411670 ~ 13495376 (+)
G157410 LOC107737553,LOC107703053,LOC107591147,LOC107687419,LOC107716113 non-coding upstream 496492 13438275 ~ 13441951 (+)
G157471 epha2 non-coding downstream 52 13939406 ~ 13939898 (+)
G157472 NA non-coding downstream 924 13940278 ~ 13940490 (+)
G157473 NA non-coding downstream 1512 13940866 ~ 13941487 (+)
G157474 NA non-coding downstream 2667 13942021 ~ 13942432 (+)
G157475 LOC107737541,LOC107591085,LOC107673100,LOC107593930,LOC107716125,LOC107687430 non-coding downstream 4235 13943589 ~ 13943919 (+)
LOC122328708 LOC107737579,LOC107672049,LOC107565833,LOC107712694,LOC107687392,LOC566587,LOC107593419 other upstream 1686461 12246193 ~ 12251982 (+)
kctd6b kctd6b,rpl10,rl10,LOC107671957,LOC107570288,LOC107737715,LOC107560935,LOC108436290,LOC103399204,LOC107672042 other upstream 2191873 11697414 ~ 11746570 (+)
LOC122328549 smim4,LOC107560937,LOC107671967,LOC107737614,LOC107712735,LOC107699582,LOC107570283 other upstream 2206082 11730980 ~ 11732361 (+)
G156586 NA other upstream 2761410 11174421 ~ 11177033 (+)
LOC122328437 LOC107737657,LOC107560901,LOC107671993,LOC108435244,LOC108275530 other upstream 2852839 11077154 ~ 11085604 (+)
c1qtnf12 fam132a,LOC107591142,LOC107716139,LOC107593919,LOC107687484 other downstream 154724 14094078 ~ 14126201 (+)
si:dkey-151g10.3 LOC107737519,LOC107716153,LOC107593909,LOC107668334,LOC107673054 other downstream 360347 14299701 ~ 14343274 (+)
pkig pkig,LOC107737509,LOC107673080,LOC107574720,LOC107564651 other downstream 664439 14603793 ~ 14636817 (+)
itih6 LOC107737505,LOC107673092,LOC107574689,LOC107695841,LOC107716181,LOC107564649 other downstream 670175 14609529 ~ 15153978 (+)
LOC122328906 LOC107673074,LOC107737500,LOC107695835,LOC107716175,LOC107574686,LOC107564653,LOC107576192 other downstream 741506 14680860 ~ 14686618 (+)

Expression


Co-expression Network