G158423


Basic Information

Item Value
gene id G158423
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056721.1
NCBI id CM032090.1
chromosome length 19062720
location 16539536 ~ 16539832 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU234628
TGAAGCCACTGTTGTTAATGCAGAGGTGTTTGTTTAAAAGTCAAATAAGCTCAGGCATCGTGATTTACAGTCATTAGGCTCTTATGCATTATGCATCTGATCTCAGAGTTACTCGTGTTGTCTTCTATCAACGGGGACCGTAGGGTCTCTCCAGCCTTGTGTAATTACCTCTCCAGTGCTATTTTGGCCCAGTGCAGTTCTAATCATTCTCAAGCCTACTTAAACCTGTGTCCTATCACACCAACTTCAAGCATGAATAGATAAACAACTGAAAGATTACCGTAAATGCTGCATGCA

Function

GO: NA

KEGG:

id description
ko00983 Drug metabolism - other enzymes
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA

RNA id representative length rna type GC content exon number start site end site
TU234628 True 297 lncRNA 0.42 1 16539536 16539832

Neighbor

gene id symbol gene type direction distance location
LOC122329124 masp2,LOC107708846,LOC107571531 coding upstream 515 16529872 ~ 16539021 (+)
LOC122328557 sst3,cort,LOC107586562,LOC107695747,LOC107716096 coding upstream 24632 16513107 ~ 16514904 (+)
srm srm,LOC107716095,LOC107708792,LOC107586563,LOC107681959,LOC107695748,LOC107570652 coding upstream 29207 16505922 ~ 16510329 (+)
smc1a smc1a,LOC107716226,LOC107695786,LOC107586531 coding upstream 33938 16494956 ~ 16505598 (+)
l1cama LOC107708848,LOC107681982,LOC107570628,LOC107716224,LOC107586533,LOC107695787 coding upstream 49457 16445121 ~ 16490079 (+)
LOC122328394 asb8,LOC107745463,LOC107681993,LOC107570421,LOC107563629,LOC107695815 coding downstream 77337 16617169 ~ 16619703 (+)
LOC122328573 NA coding downstream 615363 17155195 ~ 17162236 (+)
rapgef3 rapgef3,LOC107723737,LOC107671875,LOC107598495,LOC107697977,LOC107756413 coding downstream 641040 17180872 ~ 17214492 (+)
dazap2 dazap2,LOC107715036,LOC107671873,LOC107756418,LOC107697974,LOC107594003,LOC107598568 coding downstream 793413 17333245 ~ 17338936 (+)
si:ch211-210c8.6 si:ch211-210c8.6,LOC107756419,LOC107598584,LOC105906836,LOC106567173 coding downstream 809417 17349249 ~ 17354410 (+)
G158117 NA non-coding upstream 573772 15964752 ~ 15965764 (+)
G158115 NA non-coding upstream 590115 15896647 ~ 15949421 (+)
G158113 NA non-coding upstream 601665 15934939 ~ 15937871 (+)
G158110 NA non-coding upstream 657644 15880663 ~ 15881892 (+)
G158074 scn8aa,LOC107695818,LOC107563626 non-coding upstream 711603 15818461 ~ 15827933 (+)
LOC122328367 NA non-coding downstream 6009 16545841 ~ 16573057 (+)
G158430 LOC107660256 non-coding downstream 9407 16549239 ~ 16549606 (+)
G158434 NA non-coding downstream 15585 16555417 ~ 16555642 (+)
G158437 NA non-coding downstream 68993 16608825 ~ 16611041 (+)
G158482 NA non-coding downstream 185280 16725112 ~ 16725449 (+)
G158152 rps26,RPS26,rps26l,LOC107563646 other upstream 456007 15983670 ~ 16083529 (+)
G158162 dnajc22,LOC107708801,LOC107716089,LOC107563648,LOC107571715,LOC107695753 other upstream 516142 16022199 ~ 16023394 (+)
G157620 NA other upstream 1234986 15300704 ~ 15304550 (+)
G157656 megf11,LOC107583869,LOC107672222,LOC107596974,LOC107686294 other upstream 1543391 14992350 ~ 14996145 (+)
LOC122328907 mef2d,LOC107741762,LOC107549240,LOC107717782,LOC107597970,LOC107663114,LOC107689865 other upstream 1781319 14725910 ~ 14758217 (+)
LOC122328571 kmt2d,LOC107681934,LOC107716211,LOC107695802,LOC107563643 other downstream 42138 16581970 ~ 16607408 (+)
G158446 atf7a,LOC107563644,LOC107570410,LOC107745462,LOC107681998 other downstream 81366 16621198 ~ 16664314 (+)
LOC122328551 atf7b,atf7a,LOC107711055,LOC107585125,LOC107740570,LOC107667392,LOC107673513,LOC107582698,LOC107681998,LOC107716199,LOC107745462,LOC107570410,LOC107563644,LOC107695816 other downstream 95614 16635446 ~ 16669648 (+)
G158486 NA other downstream 191514 16731346 ~ 16732884 (+)
G158524 NA other downstream 542373 17082205 ~ 17082655 (+)

Expression


Co-expression Network