XLOC_006820 (si:dkeyp-77c8.2)


Basic Information

Item Value
gene id XLOC_006820
gene name si:dkeyp-77c8.2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 37186303 ~ 37189560 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00013122
GTCTATTACAGGAAGTCTCACAGTCATTACAGGAAGTGGAGGAGCAGGTGAAGACAGCCATTGAGAAAAGTGGCCCACTTCACAGGCTGGGTGCAAAAATCTCAGAGATTAAAGCAGGTCTGGGATCAGTTCAGAGCTGGTTGGAGCAGAAGAGTCTGAACTTTCCTGAAGCGGAGGTCACACAGAAGCGAGTGTGGGATGAGCTGGACGGTTTACATACTTGTCTGGCTGCAGTCGAGGTGGAGCTGCAGGATGTGAGTGAAATGCATCCAGACGAGACGCGACTGATTCTGGACAACCTGGTCAACTCACAGCAGACCCACACACGCCTCACCAAACAGGC

Function

symbol description
si:dkeyp-77c8.2 Predicted to enable actin filament binding activity. Predicted to be involved in nuclear migration. Predicted to be located in nuclear envelope. Predicted to be part of meiotic nuclear membrane microtubule tethering complex. Predicted to be active in cytoplasm and nuclear outer membrane.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000093000

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00013122 True 343 mRNA 0.52 3 37186303 37189560

Neighbor

gene id symbol gene type direction distance location
XLOC_006818 si:dkeyp-77c8.1 coding downstream 5488 37171976 ~ 37180815 (-)
XLOC_006819 AL845493.1 coding downstream 7587 37178602 ~ 37178716 (-)
XLOC_006816 syne2b coding downstream 58333 37075322 ~ 37127970 (-)
XLOC_006817 NA coding downstream 75767 37110212 ~ 37110536 (-)
XLOC_006815 NA coding downstream 174067 37009812 ~ 37012236 (-)
XLOC_006821 si:dkeyp-77c8.3 coding upstream 9738 37199298 ~ 37200120 (-)
XLOC_006822 si:dkeyp-77c8.4 coding upstream 18900 37208460 ~ 37210369 (-)
XLOC_006823 si:dkeyp-77c8.5 coding upstream 37490 37227050 ~ 37229245 (-)
XLOC_006824 syne2b coding upstream 59438 37248998 ~ 37254777 (-)
XLOC_006825 kcnh5b coding upstream 113015 37302575 ~ 37383625 (-)
XLOC_006471 BX537274.2 misc downstream 26921398 10264741 ~ 10264905 (-)
XLOC_006338 rn7sk misc downstream 36360078 825904 ~ 826225 (-)
XLOC_006814 NA non-coding downstream 188543 36995633 ~ 36997760 (-)
XLOC_006804 BX927407.1 non-coding downstream 574144 36587770 ~ 36612159 (-)
XLOC_006829 NA non-coding upstream 338601 37528161 ~ 37535785 (-)
XLOC_006836 NA non-coding upstream 443066 37632626 ~ 37636598 (-)
XLOC_006842 NA non-coding upstream 1000961 38190521 ~ 38195214 (-)
XLOC_006843 NA non-coding upstream 1423665 38613225 ~ 38619719 (-)
XLOC_006846 BX323574.1 non-coding upstream 1663577 38853137 ~ 38853252 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G72060 NA non-coding CI01000012 null 4757073 ~ 4767781 (-)