mipb (mipb,LOC107565996,LOC107705750)


Basic Information

Item Value
gene id mipb
gene name mipb,LOC107565996,LOC107705750
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056721.1
NCBI id CM032090.1
chromosome length 19062720
location 4288270 ~ 4289469 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043225271.1
GGATCTCGTGAAGCATGATGTGGGAGTTCCGCTCTATGATGTTCTGGCGGGCGGTGTTCGCCGAGTTCTTCGGCACCATGTTCTTCGTCTTCTTCGGGATGGGCGCAGCGCTGCGCTGGACCTCGGGGCCGTACCACGTCTTCCACACCGCCCTCTGCTTCGGTTTCGCGGCCGCCACGCTCATCCAGTCCATCGGCCACATCAGCGGAGGACACATCAACCCGGCCGTCACCTTCGCCTACTTAGTCGGCTCTCAGATGTCCTTTTTCCGAGCTTTCTTCTACATCTGCGCTCAGTGCATGGGGGCCATGGCAGGAGCCGCGGCCCTGTACGGAGTTACACCCAACAACATGAGAGGCACACTGGCACTTAACACGCTGCAGCCCGGCATGAGTCTCGGCATGGCGACTACAGTGGAGGTGTTTCTTACCATGCAGTTGGTGGTCTGCGTTTTCGCCGTCACAGACGAGAGACGAAACGGACGCTTGGGGTCAGCCGCTCTGTCTATTGGCTTCTCTATCACCATGGGCCACCTGATGGGGATGTACTACACCGGAGCCGGCATGAACCCGGCGAGATCTTTCGCTCCTGCGGTTATCATGAGGAATTTCATCAACCACTGGGTGTACTGGGTGGGGCCTATGATTGGTGGCGCTATGGGTGCCATCCTGTACGATTTCATGCTGTTTCCCCGTATGCGGGGCTTCTCCGAGCGGCTAGCCACTCTCAAGGGCAGCCGACCCCCGGGGGCCGAGAACCAGCAAGAGACAATCGGGGAGACCATCGAGCTGAAGACTCAGACCCTATAA

Function

symbol description
mipb Enables water transmembrane transporter activity. Acts upstream of or within lens fiber cell morphogenesis. Predicted to be located in membrane. Predicted to be active in plasma membrane. Predicted to be integral component of membrane. Is expressed in eye; lens; lens fiber cell; and solid lens vesicle. Human ortholog(s) of this gene implicated in cataract and cataract 15 multiple types. Orthologous to human MIP (major intrinsic protein of lens fiber).

NR:

description
PREDICTED: lens fiber major intrinsic protein

GO:

id name namespace
GO:0002088 lens development in camera-type eye biological_process
GO:0055085 transmembrane transport biological_process
GO:0006833 water transport biological_process
GO:0016021 integral component of membrane cellular_component
GO:0015250 water channel activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043225271.1 True 809 mRNA 0.59 4 4288270 4289469

Neighbor

gene id symbol gene type direction distance location
bmp7b bmp7b,bmp7,LOC107750885,LOC107565994,LOC107673428,LOC107696936 coding downstream 41132 4209314 ~ 4247138 (-)
csrp1a csrp1a,csrp1,LOC107697020,LOC107559179,LOC107673143,LOC107707378,LOC100304834 coding downstream 360364 3922484 ~ 3927906 (-)
phlda3 phlda3,LOC107673137,LOC107598124,LOC107746504,LOC107697022,LOC107559178 coding downstream 368448 3917778 ~ 3919822 (-)
tnni1a tnni1a,LOC107598157,LOC107746527,LOC107673122,LOC107696961,LOC103149619 coding downstream 374779 3907262 ~ 3913491 (-)
tnnt2a tnnt2a,LOC107559170,LOC107696942 coding downstream 394594 3882020 ~ 3893676 (-)
LOC122328525 LOC107696959,LOC107601327,LOC107565993,LOC107673245,LOC101885864,LOC103025508,LOC107750891 coding upstream 2764 4292233 ~ 4298594 (-)
baz2a baz2a,LOC107697014,LOC107673266,LOC107705669,LOC107601319 coding upstream 14086 4303555 ~ 4327917 (-)
ptges3b ptges3b,LOC107750889,LOC107601352,LOC107673275,LOC107697015,LOC107705749 coding upstream 41246 4330715 ~ 4337025 (-)
LOC122328988 LOC107697013,LOC107750890,LOC107601349,LOC101884738,LOC107705748 coding upstream 50618 4340087 ~ 4342639 (-)
trim35-39 NA coding upstream 228367 4517836 ~ 4521780 (-)
LOC122328378 NA non-coding downstream 86130 4200644 ~ 4202140 (-)
G154787 NA non-coding downstream 222741 4063965 ~ 4065529 (-)
G154789 NA non-coding downstream 223390 4063523 ~ 4064880 (-)
G154783 NA non-coding downstream 237690 4050290 ~ 4050580 (-)
G154764 NA non-coding downstream 349220 3938573 ~ 3939050 (-)
G154933 NA non-coding upstream 257414 4546883 ~ 4550218 (-)
G155085 NA non-coding upstream 390514 4679983 ~ 4680279 (-)
G155092 NA non-coding upstream 418196 4707665 ~ 4710337 (-)
G155093 NA non-coding upstream 423220 4712689 ~ 4713082 (-)
G155096 NA non-coding upstream 438385 4727854 ~ 4731140 (-)
LOC122329268 LOC107707377,LOC107673205,LOC107746501,LOC107697018,LOC107601321,LOC107598138,LOC108443130,LOC103026736,LOC106572423 other downstream 93272 4173914 ~ 4194998 (-)
lad1 LOC107746516,LOC107696941,LOC107559160 other downstream 382378 3894966 ~ 3905892 (-)
tspan2b tspan2b,LOC107709234,LOC107696969,LOC107746340,LOC107566064,LOC107673514,LOC107554202 other downstream 770128 3502265 ~ 3518142 (-)
LOC122328836 LOC107566068 other downstream 842306 3434124 ~ 3445964 (-)
G154445 NA other downstream 1336642 2925305 ~ 2951628 (-)
LOC122329181 LOC107601337,LOC107697001,LOC107723119 other upstream 538009 4827478 ~ 4834520 (-)
G155227 si:zfos-452g4.1,LOC107724183,LOC107663057,LOC107696954,LOC107551515,LOC107705659,LOC107593949 other upstream 1164948 5454417 ~ 5455047 (-)
LOC122329286 nav1b,LOC107666060,LOC107595432,LOC107740254,LOC107696445,LOC107587625 other upstream 1188372 5477841 ~ 5479822 (-)
LOC122329188 LOC107709248,LOC107687290,LOC107558915,LOC107671882,LOC107572785,LOC107723742,LOC107701749,LOC107549048,LOC107756350 other upstream 1194743 5484212 ~ 5496474 (-)
G155489 LOC107681366,LOC107727023,LOC107705691 other upstream 2441382 6730851 ~ 6731886 (-)

Expression


Co-expression Network