Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

ornamental fish

LOC122328463

Basic Information

Item	Value
gene id	LOC122328463
gene name	NA
gene type	non-coding
species	tiger barb (Puntius tetrazona)
category of species	ornamental fish

Chromosome Information

Item	Value
chromosome id	NC_056721.1
NCBI id	CM032090.1
chromosome length	19062720
location	320273 ~ 320626 (-)
genome version	ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006247796.1
TTTATCCACATGCCAGCTGCAAGGAATGAAGATGCTCGTCAAAGTTAAGTTCAGAAGTGAACAGAAGTATGTGAAAGTTTCTCACAGCGATTTGAAACTTTCCGATTTTCTGGATGAAGCCTTAGTGAAGTTCGGCATCAGTGTCTCTAGTAGGCCCGAGGCCCGTCTTTCTGACGAGTCTGGC

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
XR_006247796.1	True	184	lncRNA	0.46	3	320273	320626

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
LOC122329137	NA	coding	downstream	9696	308363 ~ 310577 (-)
LOC122329136	NA	coding	downstream	54241	258605 ~ 266032 (-)
tnnc1a	tnnc1a,LOC108427795,LOC107684904,LOC107736944,LOC100708228,LOC107566179,LOC107568483,LOC103385538	coding	upstream	488298	808924 ~ 834581 (-)
raf1a	raf1a,LOC107713759,LOC107684881,LOC108427788	coding	upstream	562566	883192 ~ 895323 (-)
gp9	LOC107736950,LOC107675164,LOC107564798	coding	upstream	582882	903508 ~ 905461 (-)
LOC122329272	LOC107736949,LOC107675168,LOC107564797,LOC107555789,LOC107684883,LOC108181449,LOC107713762,LOC107684884,LOC107555806	coding	upstream	584985	905611 ~ 958991 (-)
nup210	nup210,LOC107684885,LOC107555788,LOC107675171,LOC107736952,LOC107564796,LOC107713743	coding	upstream	645048	965674 ~ 991444 (-)
G153750	NA	non-coding	downstream	43465	276168 ~ 276808 (-)
G153749	NA	non-coding	downstream	52092	267916 ~ 268181 (-)
G153753	NA	non-coding	upstream	41023	361649 ~ 363238 (-)
G153757	NA	non-coding	upstream	255298	575924 ~ 584582 (-)
LOC122328560	NA	non-coding	upstream	255363	575989 ~ 576834 (-)
LOC122328559	NA	non-coding	upstream	262517	583143 ~ 584491 (-)
G153760	NA	non-coding	upstream	358408	679034 ~ 683111 (-)
ndnl2	ndnl2,LOC107736943,LOC107568481,LOC107714263,LOC107660884	other	upstream	458459	779085 ~ 785879 (-)
vgll4a	LOC107675174,LOC107736947,LOC107713758,LOC107684880,LOC107555803,LOC107574679	other	upstream	544851	865477 ~ 882184 (-)
l3mbtl1	l3mbtl1,LOC107736954,LOC107564793,LOC107684891,LOC107675169	other	upstream	732751	1053377 ~ 1064774 (-)
smim29	si:dkey-226k3.4,LOC107690111,LOC107567962,LOC107724208,LOC107738791,LOC107678078,LOC107571229	other	upstream	1187072	1507698 ~ 1512329 (-)
LOC122328833	LOC107669693	other	upstream	1782084	2102710 ~ 2116883 (-)

Expression

Co-expression Network