G16163


Basic Information

Item Value
gene id G16163
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 6137962 ~ 6138220 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU18075
TGAGATTGAGGGTTTCCAGTGCTGGGCCTCCAATGCCCTTAACATCAAACAGGCGGTTGTTGGCAAAGCTGAGCCACTGTAGGTAAGTGAGCTGGCCAAACGGCTGACCCTCGAACCTCTGAAGCAGGTTACTGTCTCCCTTCACCCACAACAGCTGAGTGAGGCCGGCCAATGGAGAGAAGTCTGACAAATGATTGGAGGAGATGTCCAAGTAGCGCAGATGGATGAAGGAGCTGATCAAGGCCAGGTCTGTCAGACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU18075 True 259 lncRNA 0.27 1 6137962 6138220

Neighbor

gene id symbol gene type direction distance location
CI01000001_06121398_06124748 TNNC1.L, TNNC1B, TNNC1, TNNC1A coding upstream 13010 6121398 ~ 6124952 (+)
CI01000001_06040916_06041645 NA coding upstream 95352 6040916 ~ 6042610 (+)
CI01000001_05960289_05963221 NA coding upstream 174619 5958349 ~ 5963343 (+)
CI01000001_05942155_05943721 NA coding upstream 193943 5942155 ~ 5944019 (+)
CI01000001_05933655_05938581 FLNA coding upstream 198721 5933655 ~ 5939241 (+)
CI01000001_06297032_06300530 TNNC2, TNNC2.L coding downstream 158812 6297032 ~ 6300660 (+)
CI01000001_06303405_06305351 TNNC2 coding downstream 165185 6303405 ~ 6305351 (+)
CI01000001_06309664_06321614 SLC35C2 coding downstream 171141 6309361 ~ 6322088 (+)
CI01000001_06325915_06358454 SLC35C2, COL20A1 coding downstream 186854 6325074 ~ 6358674 (+)
CI01000001_06363645_06370085 ADNP coding downstream 225425 6363645 ~ 6370101 (+)
G16040 NA non-coding upstream 11497 6105709 ~ 6126465 (+)
G16141 NA non-coding upstream 54518 6082686 ~ 6083444 (+)
G16134 NA non-coding upstream 69094 6068608 ~ 6068868 (+)
G16131 NA non-coding upstream 80614 6057139 ~ 6057348 (+)
G16112 NA non-coding upstream 128580 6008239 ~ 6009382 (+)
G16171 NA non-coding downstream 28472 6166692 ~ 6170565 (+)
G16172 NA non-coding downstream 38403 6176623 ~ 6177132 (+)
G16188 NA non-coding downstream 69412 6207632 ~ 6208354 (+)
G16189 NA non-coding downstream 70332 6208552 ~ 6208780 (+)
G16193 NA non-coding downstream 88639 6226859 ~ 6227145 (+)
G15995 NA other upstream 423011 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 848006 5279837 ~ 5287698 (+)
G15794 NA other upstream 1073258 5061218 ~ 5064704 (+)
CI01000001_03618075_03620436 NA other upstream 2516511 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 4466958 1667762 ~ 1671167 (+)
CI01000001_07531945_07539781 NA other downstream 1394352 7531541 ~ 7540586 (+)
G17234 NA other downstream 1893904 8032124 ~ 8032483 (+)
G17353 NA other downstream 3077802 9216022 ~ 9228859 (+)
G17354 NA other downstream 3096243 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 3280108 9435836 ~ 9436373 (+)

Expression


Co-expression Network