G16223 (txn2,LOC107745512)


Basic Information

Item Value
gene id G16223
gene name txn2,LOC107745512
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 2112037 ~ 2114339 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU24133
GTTTTATCTTCACCAGACGCTCATAACGGTTCTCGTGTTCTGTGGTCTCGGCAGGCGTGTTTTCCGTGGTTCTAGCGGACAGCCGTACCCCGTACTCGATGGCGAGGTCCGTGTGTTCGTCGATGTCGACTTTGGCCATGGTCACGCGGCCCTTCTGCTTGGCGATGGCCTTCTCCAGCCGCGGGCCGAGGATCTTACACGGACCACACCACCTTTGCGCGTGGAAGTCGACGAGGACGGGCAGCTGGCTGTTGATGACTCGGTCGGTGAAGTCGTCGTGGTCCTGCACGTTGAAGGACACGCTCCTGCGGGAGGACAGCGGGAGGAGGCGCGGGAGCGGGAGCAGCGCCGGAGACGGGCTCAGAGCCGAGGAGAAGGACGAGGAGCACCAGACGGCGGCCGGCGGACGCCTCGCATCCCTGACGGAAAGCCCACAAACCCTCCGAGCCAGCAGCCTGAACGCCATCTACACCACAGA

Function

symbol description
txn2 Predicted to enable protein-disulfide reductase activity. Predicted to act upstream of or within cell redox homeostasis and glycerol ether metabolic process. Human ortholog(s) of this gene implicated in combined oxidative phosphorylation deficiency 29. Orthologous to human TXN2 (thioredoxin 2).

NR:

description
PREDICTED: thioredoxin, mitochondrial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU24133 True 478 TUCP 0.64 2 2112037 2114339

Neighbor

gene id symbol gene type direction distance location
rangap1a rangap1,rangap1a,LOC107745514,LOC107722837 coding upstream 101606 2002679 ~ 2010431 (+)
LOC122333258 LOC107575253,LOC107595184,LOC107748256,LOC107740842,LOC107718680 coding upstream 170244 1925747 ~ 1941793 (+)
LOC122330213 plbd1,LOC107563730,LOC107572281,LOC107672894 coding upstream 241427 1867624 ~ 1870610 (+)
LOC122332958 NA coding upstream 382040 1728370 ~ 1729997 (+)
LOC122329718 LOC107575253,LOC107595184,LOC107748256,LOC107740842,LOC107718680 coding upstream 384344 1711295 ~ 1727693 (+)
si:ch211-106h11.3 LOC107691099,LOC107708266,LOC107755605,LOC107563746,LOC107672933,LOC107574113 coding downstream 16879 2131218 ~ 2140821 (+)
LOC122341668 LOC107755616,LOC107672923 coding downstream 147271 2261610 ~ 2267508 (+)
LOC122341669 LOC107745245,LOC107575245,LOC107755608,LOC107672924 coding downstream 153249 2267588 ~ 2270464 (+)
LOC122333376 NA coding downstream 178964 2293303 ~ 2296045 (+)
LOC122341568 LOC107672927,LOC107755614,LOC107742419,LOC107712223 coding downstream 209361 2323700 ~ 2340093 (+)
G16238 myh9b,myh9,LOC106957010,LOC107751969 non-coding upstream 33187 2075160 ~ 2078850 (+)
G16219 myh9,LOC107745511,LOC107672897,LOC107691111 non-coding upstream 42322 2063565 ~ 2069715 (+)
G16226 NA non-coding upstream 56037 2050185 ~ 2056000 (+)
G16243 LOC107755616,LOC107672923 non-coding upstream 65653 2043651 ~ 2046384 (+)
G16233 NA non-coding upstream 81194 2028394 ~ 2030843 (+)
G16241 NA non-coding downstream 27888 2142227 ~ 2143806 (+)
G16218 ddx39ab,LOC107563749,LOC107755611,LOC107672936,LOC107708265,LOC107691101,LOC107563747 non-coding downstream 29530 2143869 ~ 2150485 (+)
G16246 NA non-coding downstream 77747 2192086 ~ 2243135 (+)
G16240 NA non-coding downstream 127947 2242286 ~ 2302128 (+)
G16239 NA non-coding downstream 129018 2243357 ~ 2244932 (+)
trnar-ccu_2 NA other upstream 246252 1865713 ~ 1865785 (+)
G16002 pick1,LOC107734822,LOC107734770 other upstream 246808 1619312 ~ 1865229 (+)
trnar-ccu_1 NA other upstream 461309 1650656 ~ 1650728 (+)
G16003 pick1,LOC107734822,LOC106607154 other upstream 462543 1559387 ~ 1649494 (+)
LOC122333054 LOC107708263,LOC107691115,LOC107755610,LOC107563748,LOC107672908 other downstream 46007 2160346 ~ 2165693 (+)
G16347 NA other downstream 453745 2568084 ~ 2568999 (+)
sumo2b sumo2,sumo2b,LOC108411789,LOC103045390,LOC108441874 other downstream 526807 2641146 ~ 2646756 (+)
G16530 LOC107601546 other downstream 1168651 3282990 ~ 3283656 (+)
G16541 LOC107553655,LOC107673212,LOC107601591,LOC107716265 other downstream 1206481 3320820 ~ 3323054 (+)

Expression


Co-expression Network