G16693 (abca3b,abca3,LOC107678264,LOC107718613,LOC107553624,LOC107742093,LOC107601545)


Basic Information

Item Value
gene id G16693
gene name abca3b,abca3,LOC107678264,LOC107718613,LOC107553624,LOC107742093,LOC107601545
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 4042872 ~ 4043399 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU24840
TAGCTGCGGACAAGTTTGTCAGCATGAGGTTCGAGCAGCAGCGAACGCAGGACGTTTTCTACACAGGCTGTGACATATTTCTCCGGGATGCCCCTCAGTCTGGCGTACATGCTCAGGGTTTCCCGCCCTGTCATGTGATCTAGCACCGCGTCAAACTGGGGACAGTAACCAATTCTCTGCTGCACCTTTTTTCACATCCCGGAGGATGCTGTAGCCATCAATGAAGGCATCTCCTGAGGTTATGCTTTCATCTCCCGTCAGCATTTTGAACGTCGTAGTCTTCCCTGCTCCGTTAAATCCCAGTAAACCAAAGCACTCGCCCTTCCCAACAGCCAAAGACAGACGGTCCACCGCTAACAGCGACTGCCCGCCTGAATATAC
>TU24841
TTCTAACCACCCAATCAATCATCTCTATCCACTTTCTCTCAGGTGTCATGTTCATACCTGTAGCTGCGGACAAGTTTGTCAGCATGAGGTTCGAGCAGCAGCGAACGCAGGACGTTTTCTACACAGGCTGTGACATATTTCTCCGGGATGCCCCTCAGTCTGGCGTACATGCTCAGGGTTTCCCGCCCTGTCATGTGATCTAGCACCGCGTCAAACTGGGGACAGTAACCAATTCTCTGCTGCACCTTTTCACATCCCGGAGGATGCTGTAGCCATCAATGAAGGCATCTCCTGAGGTTATGCTTTCATCTCCCGTCAGCATTTTGAACGTCGTAGTCTTCCCTGCTCCGTTAAATCCCAGTAAACCAAAGCACTCGCCCTTCCCAACAGCCAAAGACAGACGGTCCACCGCTAACAGCGACTGCCCGCCTGAATATAC

Function

symbol description
abca3b Predicted to enable ATPase-coupled transmembrane transporter activity and lipid transporter activity. Predicted to be involved in lipid transport. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in intracellular membrane-bounded organelle. Is expressed in swim bladder. Human ortholog(s) of this gene implicated in pulmonary alveolar proteinosis. Orthologous to human ABCA3 (ATP binding cassette subfamily A member 3).
abca3 Enables ABC-type xenobiotic transporter activity; phosphatidylcholine flippase activity; and phosphatidylcholine transfer activity. Involved in several processes, including drug export; drug transmembrane transport; and positive regulation of lipid transport. Located in alveolar lamellar body membrane; late endosome; and plasma membrane. Implicated in pulmonary alveolar proteinosis.

NR:

description
PREDICTED: ATP-binding cassette sub-family A member 3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU24840 False 381 lncRNA 0.29 2 4042932 4043399
TU24841 True 439 lncRNA 0.51 2 4042872 4043399

Neighbor

gene id symbol gene type direction distance location
LOC122333504 LOC107695702,LOC107724673,LOC107601588,LOC107673211,LOC107553654,LOC107716264 coding upstream 92217 3947832 ~ 3950655 (+)
LOC122340641 LOC107724675,LOC107673198,LOC107601590,LOC107695672,LOC107716262,LOC107553642 coding upstream 104450 3928348 ~ 3938422 (+)
LOC122341043 LOC107716255,LOC107673187,LOC107695671,LOC107724671 coding upstream 126436 3912009 ~ 3916436 (+)
sstr5 sstr5,LOC107601569,LOC107695669,LOC107673199,LOC107716263 coding upstream 141423 3895268 ~ 3901449 (+)
mrps7 mrps7,LOC107695700,LOC107673207,LOC107724659,LOC107579769,LOC108262546 coding upstream 165005 3875326 ~ 3877867 (+)
cfap70 cfap70,LOC107735674 coding downstream 78360 4121759 ~ 4134915 (+)
hmox2b LOC107601585,LOC107742125,LOC107695708,LOC107553648,LOC107718627,LOC107678258 coding downstream 92471 4135870 ~ 4145083 (+)
coro7 coro7,LOC107601580,LOC107715621,LOC107553663,LOC107695655,LOC108276516,LOC108431934 coding downstream 111671 4155070 ~ 4274967 (+)
pam16 pam16,LOC106601835,LOC107695711 coding downstream 231799 4275198 ~ 4276673 (+)
tfap4 tfap4,LOC105021644,LOC107553667,LOC107695712,LOC107601578,LOC107715644,LOC107718566,LOC107661646 coding downstream 274260 4317659 ~ 4328198 (+)
G16686 NA non-coding upstream 7810 4024198 ~ 4035062 (+)
G16675 NA non-coding upstream 19671 4018533 ~ 4023201 (+)
G16685 NA non-coding upstream 23183 4019247 ~ 4019689 (+)
LOC122341104 NA non-coding upstream 51319 3987526 ~ 3991553 (+)
G16664 NA non-coding upstream 97833 3944601 ~ 3945039 (+)
G16883 LOC106606498,LOC106592966 non-coding downstream 106183 4149582 ~ 4150963 (+)
G16890 LOC107601582,LOC107695709,LOC107715639,LOC107718560,LOC107661641,LOC107553664 non-coding downstream 172464 4215863 ~ 4219429 (+)
G16897 NA non-coding downstream 271732 4315131 ~ 4315467 (+)
G16898 NA non-coding downstream 273437 4316836 ~ 4317051 (+)
G16956 NA non-coding downstream 368278 4411677 ~ 4441048 (+)
G16672 NA other upstream 9346 3969515 ~ 4033526 (+)
G16667 NA other upstream 57261 3947623 ~ 3985611 (+)
LOC122332297 NA other upstream 229528 3809170 ~ 3813344 (+)
mmd mmd,LOC107695694,LOC107710982,LOC107601597,LOC107567562,LOC107696363,LOC107718937 other upstream 515958 3510076 ~ 3526914 (+)
G16541 LOC107553655,LOC107673212,LOC107601591,LOC107716265 other upstream 719818 3320820 ~ 3323054 (+)
LOC122340527 adcy9,LOC107715643,LOC107661757,LOC107695715,LOC107576850,LOC107718568 other downstream 313633 4357032 ~ 4405384 (+)
G16955 crebbp,LOC108440697 other downstream 393889 4437288 ~ 4438201 (+)
G16979 NA other downstream 415299 4458698 ~ 4462274 (+)
G16978 LOC107601574,LOC107654242,LOC107715645 other downstream 427333 4470732 ~ 4546567 (+)
G16981 NA other downstream 862257 4905656 ~ 4906966 (+)

Expression


Co-expression Network