G16247


Basic Information

Item Value
gene id G16247
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 6433084 ~ 6433328 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU18164
AGAAGATTCATAAAGCTTCATGAAGCAGTGTTTTGAAATCGCTCATCACTAGATATTGTTGAATAAACTGCCAAAGTCACGTGATTTCAGTAAACGAGGCTTCGTTATGTCATAAATGTTTCGAAATTTCAGTGGTTCATGTGACTTTGGCAGTTTGATACGCGCTCCGAACCACTGATTTGAAACAAAAGATTCGTAAAGCTTCGAAGCTTCATGAAGCATCGTTTTGAAATCGCCCATCACTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU18164 True 245 lncRNA 0.41 1 6433084 6433328

Neighbor

gene id symbol gene type direction distance location
CI01000001_06420606_06430104 CAMKVL coding upstream 2951 6420606 ~ 6430133 (+)
CI01000001_06363645_06370085 ADNP coding upstream 62983 6363645 ~ 6370101 (+)
CI01000001_06325915_06358454 SLC35C2, COL20A1 coding upstream 74410 6325074 ~ 6358674 (+)
CI01000001_06309664_06321614 SLC35C2 coding upstream 110996 6309361 ~ 6322088 (+)
CI01000001_06303405_06305351 TNNC2 coding upstream 127733 6303405 ~ 6305351 (+)
CI01000001_06442969_06455699 UBA1 coding downstream 9641 6442969 ~ 6455859 (+)
CI01000001_06458769_06470107 ARHGEF3L coding downstream 25441 6458769 ~ 6470495 (+)
CI01000001_06474891_06479887 USP21 coding downstream 41563 6474891 ~ 6480025 (+)
CI01000001_06484769_06502296 CCDC30 coding downstream 51441 6484769 ~ 6504149 (+)
CI01000001_06519105_06525958 NA coding downstream 85305 6518633 ~ 6526120 (+)
G16212 NA non-coding upstream 150532 6282339 ~ 6282552 (+)
G16193 NA non-coding upstream 205939 6226859 ~ 6227145 (+)
G16189 NA non-coding upstream 224304 6208552 ~ 6208780 (+)
G16188 NA non-coding upstream 224730 6207632 ~ 6208354 (+)
G16172 NA non-coding upstream 255952 6176623 ~ 6177132 (+)
G16257 NA non-coding downstream 81793 6515121 ~ 6515398 (+)
G16284 NA non-coding downstream 238854 6672182 ~ 6673511 (+)
CI01000001_06718133_06747744 KCNAB2.L, KCNAB2A, KCNAB2B, KCNAB2 non-coding downstream 290481 6717159 ~ 6747744 (+)
G16317 NA non-coding downstream 366840 6800168 ~ 6800381 (+)
CI01000001_06893068_06917387 IFFO2A non-coding downstream 482459 6893068 ~ 6917660 (+)
G15995 NA other upstream 718133 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 1143128 5279837 ~ 5287698 (+)
G15794 NA other upstream 1368380 5061218 ~ 5064704 (+)
CI01000001_03618075_03620436 NA other upstream 2811633 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 4762080 1667762 ~ 1671167 (+)
CI01000001_07531945_07539781 NA other downstream 1099244 7531541 ~ 7540586 (+)
G17234 NA other downstream 1598796 8032124 ~ 8032483 (+)
G17353 NA other downstream 2782694 9216022 ~ 9228859 (+)
G17354 NA other downstream 2801135 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 2985000 9435836 ~ 9436373 (+)

Expression


Co-expression Network