G16955 (crebbp,LOC108440697)


Basic Information

Item Value
gene id G16955
gene name crebbp,LOC108440697
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 4437288 ~ 4438201 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU25239
TCCTGACACTGGCCAGGGACAAGCACTGGGAGTTCAGTTCCCTGCGTCGTTGCAAATGGAGCACTATGTGCATGCTGGTGGAGCTACACAATCAGGGCCAAGACCGATTTGTGTACACTTGCAACGAATGCAAGCACCATGTAGAGACACGCTGGCATTGTACCGTATGCGAGGACTTTGATCTATGCATTAACTGCTACAACTCCAAGGGCCACGAGCACCAAATGGTGAAGTGGGGTTTGGGCCTCGACGACGACAGCAACAACCAGAGTGGCGAGGCCAACAAGAGTCCACAGGAGAGTCGACGCCTCAGCATCCAGCGCTGCATCCAGTCATTGGTGCATGCCTGCCAGTGCCGCAACGCCAACTGCTCTCTGCCGTCTTGTCAGAAGATGAAGAGAGTGGTGCAGCACACCAAGGGCTGCAAGCGCAAGACCAACGGAGGCTGCCCCGTTTGCAAGCAACTCATCGCGTTGTGCTGCTACCATGCCAAGCACTGCCAGGAGAACAAGTGCCCCGTGCCCTTCTGTCTCAATATCAAGCACAAGCTGCGCCAGCAGCAGATTCAGCAGCGGCTGCAGCAGGCGCAGATGATGCGCCGGCGCATGGCACTCATGCAGGGCAGAGGAATGCCGCCCAGTCTGCCCTCCCCAACTACCTCAGGAGGTCCAGGGC

Function

symbol description
crebbp Enables several functions, including DNA-binding transcription factor binding activity; p53 binding activity; and transcription coactivator binding activity. Involved in several processes, including histone glutamine methylation; peptidyl-lysine acetylation; and regulation of transcription by RNA polymerase II. Located in chromatin; cytoplasm; and nuclear body. Implicated in Rubinstein-Taybi syndrome; acute lymphoblastic leukemia; and acute myeloid leukemia. Biomarker of Huntington's disease.

NR:

description
PREDICTED: CREB-binding protein

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU25239 True 675 TUCP 0.42 2 4437288 4438201

Neighbor

gene id symbol gene type direction distance location
srl srl,LOC107661647,LOC107718567,LOC107553668,LOC107695714 coding upstream 85528 4329686 ~ 4351760 (+)
tfap4 tfap4,LOC105021644,LOC107553667,LOC107695712,LOC107601578,LOC107715644,LOC107718566,LOC107661646 coding upstream 109090 4317659 ~ 4328198 (+)
pam16 pam16,LOC106601835,LOC107695711 coding upstream 160615 4275198 ~ 4276673 (+)
coro7 coro7,LOC107601580,LOC107715621,LOC107553663,LOC107695655,LOC108276516,LOC108431934 coding upstream 162321 4155070 ~ 4274967 (+)
hmox2b LOC107601585,LOC107742125,LOC107695708,LOC107553648,LOC107718627,LOC107678258 coding upstream 292205 4135870 ~ 4145083 (+)
LOC122340833 LOC107718621 coding downstream 32531 4470732 ~ 4479122 (+)
LOC122333567 LOC107660259 coding downstream 63851 4502052 ~ 4533340 (+)
LOC122340567 trap1 coding downstream 221159 4659360 ~ 4668688 (+)
LOC122341974 rorcb,LOC107757806,LOC107698501,LOC108433101,LOC107713654 coding downstream 292227 4730428 ~ 4741427 (+)
sh3gl1a sh3gl1a,LOC107600226,LOC107713652,LOC107698500,LOC107662987,LOC107599254 coding downstream 306632 4744833 ~ 4761297 (+)
G16898 NA non-coding upstream 120237 4316836 ~ 4317051 (+)
G16897 NA non-coding upstream 121821 4315131 ~ 4315467 (+)
G16890 LOC107601582,LOC107695709,LOC107715639,LOC107718560,LOC107661641,LOC107553664 non-coding upstream 217859 4215863 ~ 4219429 (+)
G16883 LOC106606498,LOC106592966 non-coding upstream 286325 4149582 ~ 4150963 (+)
G16693 abca3b,abca3,LOC107678264,LOC107718613,LOC107553624,LOC107742093,LOC107601545 non-coding upstream 393889 4042872 ~ 4043399 (+)
G16958 NA non-coding downstream 3815 4442016 ~ 4442308 (+)
G16982 LOC107553672,LOC107724861,LOC107660259,LOC107718569,LOC107601574,LOC107715645,LOC107654242,LOC107718570 non-coding downstream 114184 4552385 ~ 4657048 (+)
G16984 LOC107757310 non-coding downstream 118620 4556821 ~ 4614430 (+)
G16990 NA non-coding downstream 163823 4602024 ~ 4650638 (+)
G16991 NA non-coding downstream 165853 4604054 ~ 4654254 (+)
LOC122340527 adcy9,LOC107715643,LOC107661757,LOC107695715,LOC107576850,LOC107718568 other upstream 31904 4357032 ~ 4405384 (+)
G16672 NA other upstream 403762 3969515 ~ 4033526 (+)
G16667 NA other upstream 451677 3947623 ~ 3985611 (+)
LOC122332297 NA other upstream 623944 3809170 ~ 3813344 (+)
mmd mmd,LOC107695694,LOC107710982,LOC107601597,LOC107567562,LOC107696363,LOC107718937 other upstream 910374 3510076 ~ 3526914 (+)
G16979 NA other downstream 20497 4458698 ~ 4462274 (+)
G16978 LOC107601574,LOC107654242,LOC107715645 other downstream 32531 4470732 ~ 4546567 (+)
G16981 NA other downstream 467455 4905656 ~ 4906966 (+)
elof1 elof1,LOC103393660,LOC100703874,LOC106589640,LOC106935058,LOC103384163 other downstream 872292 5310493 ~ 5312371 (+)
nfil3-2 nfil3-2,LOC107659565,LOC107550255,LOC107711126,LOC107718587,LOC107563256,LOC107656794 other downstream 977557 5415758 ~ 5480607 (+)

Expression


Co-expression Network