G17315


Basic Information

Item Value
gene id G17315
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 5647245 ~ 5648079 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU25853
TGAAGGCCAGCCAGGTCTGTCTGATGTGCAGGTACACGGAGAAATCAGGCTGGAAGCCCAGCTGCTGCAGGGTGATGTTAGAACCAGGCGTGTCCTTCAGATTAACGTACTTTATGCTGCAGTAAGCAATGCCTGGGTAAGAAACAGACAATCATACAGTTTAACATACACTGGACAGGAGGGATGTATTGAAGAGTAAGAGCCATACCATACCACAGGCAACGACAATGATGACCATGAGGATCATGACCCAGACCATGACTCCAGCCAGAAAACGCAGGAGAACGATGAAGATCAGACTCAGCACCACAGCGATCACCAAACAACTGCACGGAGAAACAGATTTATACTCCGTCACAGGAAGAC

Function

GO:

id name namespace
GO:0060070 canonical Wnt signaling pathway biological_process
GO:0065007 biological regulation biological_process
GO:0090090 negative regulation of canonical Wnt signaling pathway biological_process
GO:0007166 cell surface receptor signaling pathway biological_process
GO:0021514 ventral spinal cord interneuron differentiation biological_process

KEGG:

id description
ko05217 Basal cell carcinoma

RNA

RNA id representative length rna type GC content exon number start site end site
TU25853 True 366 lncRNA 0.49 2 5647245 5648079

Neighbor

gene id symbol gene type direction distance location
gcdhb gcdhb,gcdh,LOC107718595,LOC107653471,LOC107731476,LOC107563244,LOC102794743 coding upstream 66504 5574401 ~ 5580741 (+)
LOC122331145 NA coding upstream 73031 5566565 ~ 5574214 (+)
LOC122331179 LOC107550260,LOC107659569 coding upstream 91106 5551196 ~ 5556139 (+)
LOC122341561 LOC107711124,LOC107659564,LOC107550256,LOC107718588,LOC107656793,LOC107579440 coding upstream 234112 5409599 ~ 5413133 (+)
swsap1 LOC107550247 coding upstream 364924 5280179 ~ 5282321 (+)
tufm tufm,LOC107718598,LOC107659578,LOC107731475,LOC101070424,LOC106931188 coding downstream 168964 5817043 ~ 5821892 (+)
amdhd2 amdhd2,LOC107661858,LOC107718599,LOC107653464,LOC107753757 coding downstream 277150 5925229 ~ 5933647 (+)
slc25a19 slc25a19,LOC107661860,LOC107563233,LOC107565621,LOC107653449,LOC107718625 coding downstream 289353 5937432 ~ 5942586 (+)
LOC122341440 fbxw9,LOC107661857 coding downstream 301070 5949149 ~ 5954642 (+)
dhps dhps,LOC107661880,LOC107563249,LOC107653447,LOC106592861 coding downstream 458354 6106433 ~ 6110339 (+)
G17300 NA non-coding upstream 52698 5593986 ~ 5594547 (+)
G17115 NA non-coding upstream 129381 5450539 ~ 5517864 (+)
G17112 NA non-coding upstream 241082 5405770 ~ 5406163 (+)
G17056 NA non-coding upstream 389493 5254500 ~ 5257752 (+)
G17061 NA non-coding upstream 426873 5219650 ~ 5220372 (+)
G17322 NA non-coding downstream 42456 5690535 ~ 5695636 (+)
G17312 LOC107550264,LOC107659563,LOC107653452,LOC107563254,LOC107718634 non-coding downstream 87010 5735089 ~ 5737125 (+)
G17337 NA non-coding downstream 103902 5751981 ~ 5752280 (+)
G17405 LOC107661884,LOC107753766,LOC107565624,LOC107718602 non-coding downstream 297214 5945293 ~ 5947708 (+)
G17412 NA non-coding downstream 465127 6113206 ~ 6113606 (+)
G17302 NA other upstream 49013 5597099 ~ 5598232 (+)
LOC122331163 LOC107653472,LOC107718593,LOC107563253 other upstream 81271 5557008 ~ 5565974 (+)
nfil3-2 nfil3-2,LOC107659565,LOC107550255,LOC107711126,LOC107718587,LOC107563256,LOC107656794 other upstream 166638 5415758 ~ 5480607 (+)
elof1 elof1,LOC103393660,LOC100703874,LOC106589640,LOC106935058,LOC103384163 other upstream 334874 5310493 ~ 5312371 (+)
G16981 NA other upstream 740279 4905656 ~ 4906966 (+)
LOC122341474 dhps,LOC107661880,LOC107563249,LOC107653447,LOC107718601,LOC107563248 other downstream 309324 5957403 ~ 5962888 (+)
fbxw9 fbxw9,LOC107661857 other downstream 450122 6098201 ~ 6103626 (+)
LOC122341437 LOC107718607,LOC107653460 other downstream 538729 6186808 ~ 6195038 (+)
G17590 NA other downstream 856836 6504915 ~ 6556750 (+)
LOC122331592 LOC107744988 other downstream 1935275 7583354 ~ 7591526 (+)

Expression


Co-expression Network