G18470 (dnmt1,LOC107670489)


Basic Information

Item Value
gene id G18470
gene name dnmt1,LOC107670489
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 9602642 ~ 9603064 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU27582
ACTCTAGAGAACATTGAAAGGATAGTTGGCTGTTTTCCAGAGTTACGCGTGACCCTGGTACTGGCTGGAGACTCTCTCACTCTTGGGCTCAGACTCTGCTTTACTGCGACGGCCGCCCCTTCCCTTGGGGGCGCTGGGAGACTTTATAGCATCTCCTTCCTCCTGAGTATCCATGGCTCCCTCCTTCTCGCCTTCGTGAGACCCATTTTCAGAGAAGCCGTTTGAATGTCCGTTCTGCTCCACGCCATCATCCTCTTTGACTACTCCCAGAGCTTTCTTCAGCACGGCCTTTACCTCCGACATGTAAACCT

Function

symbol description
dnmt1 Enables DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates. Involved in negative regulation of gene expression. Acts upstream of or within several processes, including Kupffer's vesicle development; animal organ development; and macromolecule methylation. Predicted to be active in nucleus. Is expressed in several structures, including digestive system; immature eye; nervous system; neural tube; and tail bud. Human ortholog(s) of this gene implicated in Graves' disease; autosomal dominant cerebellar ataxia, deafness and narcolepsy; hereditary sensory neuropathy; hereditary sensory neuropathy type 1E; and lung non-small cell carcinoma. Orthologous to human DNMT1 (DNA methyltransferase 1).

NR:

description
PREDICTED: protein NLRC3-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU27582 True 311 lncRNA 0.57 2 9602642 9603064

Neighbor

gene id symbol gene type direction distance location
eif3g eif3g,LOC107672439,LOC107711270,LOC107754044,LOC107670490 coding upstream 11351 9588010 ~ 9591291 (+)
p2ry11 p2ry11,LOC107711269,LOC107672502,LOC107670465,LOC107754043 coding upstream 16424 9582374 ~ 9586218 (+)
ppan ppan,LOC107672501,LOC107711268,LOC107670430,LOC107754053 coding upstream 20257 9577725 ~ 9582385 (+)
olfm2a olfm2a,olfm2,LOC107563315,LOC107670519 coding upstream 115454 9428864 ~ 9487188 (+)
col5a3a col5a3a,LOC107672483,LOC107711265,LOC107563316,LOC107757338,LOC107670510,LOC107587984 coding upstream 201832 9353698 ~ 9400810 (+)
icam3 NA coding downstream 53488 9656552 ~ 9666605 (+)
LOC122341977 NA coding downstream 64503 9667567 ~ 9672804 (+)
mgrn1b mgrn1,mgrn1b,LOC107754037,LOC107672503,LOC107711275,LOC107670506 coding downstream 76834 9679898 ~ 9692637 (+)
mpg si:xx-by187g17.9,LOC107596818,LOC107754030,LOC107670500,LOC107672429,LOC107587979,LOC107711169 coding downstream 152117 9755181 ~ 9761184 (+)
hbaa2 si:ch211-5k11.6,hbz,LOC107587927,LOC107672462,LOC107670501 coding downstream 175428 9778492 ~ 9779290 (+)
G18458 LOC107672431,LOC107711167,LOC107587937 non-coding upstream 26740 9574881 ~ 9575902 (+)
G18457 NA non-coding upstream 28153 9574289 ~ 9574489 (+)
G18456 LOC107672431,LOC107587937 non-coding upstream 28380 9573184 ~ 9574262 (+)
G18454 LOC107711167 non-coding upstream 30908 9571154 ~ 9571734 (+)
G18453 NA non-coding upstream 32359 9570038 ~ 9570283 (+)
G18502 ba1,ba2 non-coding downstream 172256 9775320 ~ 9784458 (+)
G18507 NA non-coding downstream 251539 9854603 ~ 9859173 (+)
G18517 NA non-coding downstream 262722 9865786 ~ 9943153 (+)
G18549 prkcsh,LOC107703311,LOC107725022,LOC107754018,LOC107587972 non-coding downstream 307893 9910957 ~ 9911612 (+)
G18671 NA non-coding downstream 670910 10273974 ~ 10302050 (+)
LOC122341719 pet100,LOC107563330,LOC107672445,LOC107587949 other upstream 416982 9184399 ~ 9185660 (+)
brd4 LOC107711252,LOC107587947,LOC107672460,LOC107670433,LOC107757365,LOC107563328 other upstream 419352 9138467 ~ 9183290 (+)
pgls pgls,LOC107672478,LOC107711179,LOC107757376,LOC107567243,LOC107670497 other upstream 590464 9010050 ~ 9012178 (+)
LOC122341292 LOC107729471,LOC107687638 other upstream 613832 8980591 ~ 8988810 (+)
LOC122331854 mgp,LOC107574611,LOC107569876 other upstream 1051491 8544291 ~ 8551151 (+)
aanat2 aanat2,LOC107672440,LOC107670449,LOC107588006,LOC107596820,LOC107754039 other downstream 89885 9692949 ~ 9697915 (+)
G18491 NA other downstream 136732 9739796 ~ 9749880 (+)
hbbe1.3 LOC107596825,LOC107596828,LOC107674643,LOC107754023,LOC107587921 other downstream 195751 9798815 ~ 9799796 (+)
G18574 LOC107568067,LOC107690317,LOC107733849 other downstream 422754 10025818 ~ 10103461 (+)
LOC122333995 LOC107561345,LOC107732849,LOC107680844,LOC107729518,LOC107551149,LOC107690331,LOC107732905,LOC107561346,LOC107551141 other downstream 1088826 10691890 ~ 10698540 (+)

Expression


Co-expression Network