G18599


Basic Information

Item Value
gene id G18599
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 9571600 ~ 9571805 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU27754
TACAGATAAATGCAACGTGCCAGTGAGTGCAGTAGGTCACATTCCTCTGGTGGTTTGTAGGAGTGTGAATTCCTCAATGTTGAACTGATAAGTAAAGGCTGAGAGATGGTTGTATACAGTATACAGGTCATGACCTTGCTGCTTTCTGAACCAACAGAACCGTATCCCTTTACCATCCATCCAGCTCCTCCACACCAAGACAAGAC

Function

GO:

id name namespace
GO:0051147 regulation of muscle cell differentiation biological_process
GO:0051149 positive regulation of muscle cell differentiation biological_process
GO:0051153 regulation of striated muscle cell differentiation biological_process
GO:0051155 positive regulation of striated muscle cell differentiation biological_process
GO:0048856 anatomical structure development biological_process
GO:0045597 positive regulation of cell differentiation biological_process
GO:0032502 developmental process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU27754 True 206 lncRNA 0.45 1 9571600 9571805

Neighbor

gene id symbol gene type direction distance location
icam5 NA coding downstream 2273 9563751 ~ 9569327 (-)
trip10a trip10,trip10a,LOC107596831,LOC107670505,LOC107672474 coding downstream 8218 9538376 ~ 9563382 (-)
rdh8a rdh8a,rdh8,LOC107587939,LOC107672484,LOC107711264,LOC107757358,LOC107563317,LOC107670529 coding downstream 230597 9333096 ~ 9341003 (-)
notch3 notch3,LOC107711261,LOC107587940,LOC107757359,LOC107670473,LOC107563318 coding downstream 276751 9265773 ~ 9294849 (-)
shfl zgc:171711,LOC107757360,LOC107563321,LOC107670471 coding downstream 311109 9255441 ~ 9260491 (-)
dnmt1 dnmt1,LOC107587934,LOC107672482,LOC107670489 coding upstream 20510 9592315 ~ 9605013 (-)
s1pr2 s1pr2,LOC107711272,LOC107587933,LOC107672500,LOC107596814,LOC107754042 coding upstream 35479 9607284 ~ 9629912 (-)
ubald1b ubald1b,LOC107754052,LOC107672511,LOC107670507,LOC107596822,LOC107587929 coding upstream 103413 9675218 ~ 9678951 (-)
rhbdf1a rhbdf1a,LOC107587928,LOC107711277,LOC107596807,LOC107672493,LOC107754036,LOC107670513 coding upstream 126259 9698064 ~ 9740157 (-)
nprl3 LOC107711278,LOC107596811,LOC107754028,LOC107670498,LOC107672508 coding upstream 189525 9761330 ~ 9774275 (-)
LOC122342127 NA non-coding downstream 37813 9512446 ~ 9533787 (-)
G18439 olfm2,olfm2a non-coding downstream 86245 9481321 ~ 9485355 (-)
G18426 LOC105357980 non-coding downstream 157593 9413404 ~ 9414007 (-)
G18388 NA non-coding downstream 371898 9198608 ~ 9199702 (-)
G18378 NA non-coding downstream 388329 9182539 ~ 9183271 (-)
G18602 NA non-coding upstream 18116 9589921 ~ 9591291 (-)
G18608 NA non-coding upstream 74508 9646313 ~ 9646566 (-)
G18623 NA non-coding upstream 181430 9753235 ~ 9753522 (-)
G18628 hbaa1,si:ch211-5k11.8,LOC107682494,LOC107587926 non-coding upstream 213444 9785249 ~ 9786124 (-)
G18634 LOC107596828,LOC107588005,LOC107596825,LOC107703325,LOC107587921,LOC108440249,LOC108440213 non-coding upstream 217811 9789616 ~ 9793185 (-)
G18433 LOC107670519,LOC107563315 other downstream 108695 9426572 ~ 9462905 (-)
LOC122331343 LOC107672446,LOC107711185,LOC108429658,LOC107579184,LOC107567225,LOC106600921 other downstream 433511 9134043 ~ 9138089 (-)
zgc:113210 NA other downstream 564157 8992714 ~ 9007443 (-)
fmc1 NA other downstream 1172772 8309532 ~ 8398828 (-)
LOC122342198 NA other downstream 1352545 8218902 ~ 8219055 (-)
rbfox1 rbfox1,LOC107733849,LOC107690317,LOC107685930 other upstream 422028 9993833 ~ 10210616 (-)
eef2kmt eef2kmt,LOC107690238,LOC107733874,LOC107568155,LOC107680861,LOC107738633 other upstream 822509 10394314 ~ 10396341 (-)
lrrc4ba lrrc4ba,lrrc4b,LOC107551155,LOC107680881,LOC107667844,LOC103034410,LOC107563987,LOC107732840 other upstream 1440131 11011936 ~ 11064598 (-)
syt17 syt17,LOC107729446,LOC107658452,LOC107564007,LOC107732856,LOC107674134 other upstream 1840180 11411985 ~ 11429179 (-)
map3k3 map3k3,LOC107658467,LOC107583042,LOC107570753,LOC107674169,LOC107721962 other upstream 2122467 11694272 ~ 11714719 (-)

Expression


Co-expression Network