G18946 (smg1,LOC107729485,LOC107583093,LOC107658410,LOC107732845)


Basic Information

Item Value
gene id G18946
gene name smg1,LOC107729485,LOC107583093,LOC107658410,LOC107732845
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 11380273 ~ 11380790 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU28233
CCAGTCTATGCAGCAGCTGAAGTTCCAAAGAGGAAACGGAGGTGCTGAATTGGGCAGCGTAGGAGCAGGTGGCCTGGCATCGTTTCACAAGTTCAAAAAGTGTTGCATCCATGTTCAAGGCTTCTGGGGTGCGGGTACGCAGACCTTCAAAGTTGAGAATGGTGCTGCAGAGAAAAGTAACCTGGTTTGCACGCTGACTCTCCTTCATCACTAAGGCACGGCGTTCTGCTATAGTGGCCTCAAAGTCCTGCAGTACTGGGGCAAGTGCAGGATTTGCGCCACCGGCCCACTTCAGCCTCTGCTCTATGCTGCCCTCTAAACTTGCCAACTTCTCCTGGCTGCCAATAGAAGCTTCGTCTTGACTGAGTTTGTAGAGCTTCTTCTTCATATTGCTCAGGATGATGGAGCGAGGCGGGGGACTGACCGTCA

Function

symbol description
smg1 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in TORC1 signaling and negative regulation of macroautophagy. Predicted to act upstream of or within nuclear-transcribed mRNA catabolic process, nonsense-mediated decay and phosphorylation. Predicted to be part of TORC1 complex and TORC2 complex. Predicted to be active in nucleus. Orthologous to human SMG1 (SMG1 nonsense mediated mRNA decay associated PI3K related kinase).

NR:

description
PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC108273545

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU28233 True 429 lncRNA 0.31 2 11380273 11380790

Neighbor

gene id symbol gene type direction distance location
si:dkey-66i24.8 LOC107658431,LOC107583056,LOC107729444,LOC107732851 coding upstream 13158 11362983 ~ 11367115 (+)
si:dkey-66i24.7 si:dkey-66i24.7,LOC107674138,LOC107732877,LOC107658448,LOC107563999,LOC107729523 coding upstream 34339 11344269 ~ 11345934 (+)
prf1.1 prf1.1,LOC107658428,LOC107583105,LOC107729447,LOC107732857,LOC107674141,LOC107564016 coding upstream 66904 11308682 ~ 11313369 (+)
prf1.9 LOC107729509,LOC107583107,LOC107658427 coding upstream 71716 11305325 ~ 11308557 (+)
cldni LOC107729510 coding upstream 98532 11278737 ~ 11281741 (+)
clec19a clec19a,LOC107658453,LOC107583104,LOC107736754 coding downstream 27247 11408037 ~ 11413269 (+)
LOC122341817 c1ql1,LOC107729572,LOC107658458,LOC107583048,LOC107674128,LOC103367899,LOC101070426,LOC104923905 coding downstream 116863 11497653 ~ 11515159 (+)
ccdc43 LOC107674137,LOC107729438,LOC107583050,LOC107658459,LOC107721961,LOC107564021 coding downstream 210810 11591600 ~ 11594168 (+)
fzd2 fzd2,LOC107583044,LOC107658461,LOC107729561,LOC107721960,LOC107564008,LOC107674136 coding downstream 222884 11603674 ~ 11606177 (+)
mylk5 LOC107583040,LOC107729567,LOC107658462 coding downstream 235405 11616195 ~ 11629282 (+)
G18982 NA non-coding upstream 4872 11371502 ~ 11375401 (+)
G18945 NA non-coding upstream 9292 11271168 ~ 11370981 (+)
G18960 paqr4a,paqr4,LOC107674132 non-coding upstream 85668 11289747 ~ 11294605 (+)
G18932 ppp1caa,pp1g,LOC105897688 non-coding upstream 109167 11270202 ~ 11271106 (+)
LOC122336311 NA non-coding upstream 187278 11189556 ~ 11192995 (+)
G19123 NA non-coding downstream 56154 11436944 ~ 11437197 (+)
G19126 NA non-coding downstream 59716 11440506 ~ 11441338 (+)
G19184 NA non-coding downstream 331819 11712609 ~ 11719579 (+)
LOC122338225 NA non-coding downstream 453982 11834772 ~ 11835253 (+)
G19208 NA non-coding downstream 586858 11967648 ~ 11974006 (+)
G18949 NA other upstream 10521 11368893 ~ 11369752 (+)
LOC122331261 cox6a2,LOC107564019,LOC107658449,LOC107674165,LOC107583062,LOC103367329 other upstream 44448 11333741 ~ 11335825 (+)
kcna7 LOC106518874,LOC108237811,LOC102213725,LOC102789930,LOC102292646,LOC101488024,LOC100711099,LOC105891650,LOC107729520,LOC107097254,LOC107551170,LOC102237047,LOC107551147,LOC107732850,LOC107729474,LOC107561361,LOC107680852,LOC108434931,LOC108278793 other upstream 537766 10752759 ~ 10842507 (+)
LOC122333995 LOC107561345,LOC107732849,LOC107680844,LOC107729518,LOC107551149,LOC107690331,LOC107732905,LOC107561346,LOC107551141 other upstream 681733 10691890 ~ 10698540 (+)
G18574 LOC107568067,LOC107690317,LOC107733849 other upstream 1276812 10025818 ~ 10103461 (+)
kcnc3a kcnc3a,LOC107693499,LOC107548332,LOC107729449,LOC108427388 other downstream 392410 11773200 ~ 11833924 (+)
syt5a syt5a,LOC107658481,LOC107583026,LOC107730742,LOC107548337,LOC107689676 other downstream 504865 11885655 ~ 11893656 (+)
prr12b prr12b,LOC107689691,LOC107729421,LOC107583015,LOC107658420,LOC107554076,LOC107730729 other downstream 646359 12027149 ~ 12049422 (+)
LOC122342134 LOC107729418,LOC107658494,LOC107689662,LOC107554108,LOC107583010,LOC107730753,LOC100007086 other downstream 711813 12092603 ~ 12100852 (+)
pax10 pax10,LOC107554109,LOC107658497,LOC107730756 other downstream 733258 12114048 ~ 12117939 (+)

Expression


Co-expression Network