G17951


Basic Information

Item Value
gene id G17951
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 7584537 ~ 7586098 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU20189
AGTATCACTAAAGATCAGGGCAACTGACCAGGATAATCCTTAACAAAGCTCCTGTAGAGGTCAGCCAGCTGGTCAGGGCTGATATAACGGCTGGGGTCATCAGGTGATTTGAAGTCCAGGTCGTACTTGCCATACTTCTCCTTGATGACATTCTTCAGGTTGTGATAGACCTCAGCACCAATGCGCATGGCTTCTTTGAAGTTGCTGGCACCGATGGGCAGGATCATGAACTCCTGCATGGCCAGCTTGTTGCCGGCGTGGGAACCGCCGTTGATAACGTTGAAGGCCTTTGAAAACAGACAGTCTATTTATAGTATGCCAGAGTTTGCATACTTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU20189 True 337 lncRNA 0.48 2 7584537 7586098

Neighbor

gene id symbol gene type direction distance location
CI01000001_07568083_07573146 CA6 coding downstream 11198 7568083 ~ 7573339 (-)
CI01000001_07565885_07567962 NA coding downstream 16575 7565370 ~ 7567962 (-)
CI01000001_07492000_07496973 SPSB1, SPSB4 coding downstream 87564 7491422 ~ 7496973 (-)
CI01000001_07399727_07402300 NA coding downstream 180855 7399645 ~ 7403682 (-)
CI01000001_07382559_07385351 NA coding downstream 198907 7382227 ~ 7385630 (-)
CI01000001_07609855_07631058 NA coding upstream 23722 7609820 ~ 7631285 (-)
CI01000001_07769921_07796135 NA coding upstream 182991 7769089 ~ 7796547 (-)
CI01000001_07807093_07808245 NA coding upstream 219815 7805913 ~ 7808493 (-)
CI01000001_07875805_07905655 NOC2L coding upstream 289640 7875738 ~ 7905655 (-)
CI01000001_07953501_07958007 NA coding upstream 367135 7953233 ~ 7958007 (-)
G18017 NA non-coding downstream 9402 7574901 ~ 7575135 (-)
G18015 NA non-coding downstream 28483 7555678 ~ 7556054 (-)
G18012 NA non-coding downstream 30506 7553795 ~ 7554031 (-)
G18011 NA non-coding downstream 30825 7553498 ~ 7553712 (-)
G18010 NA non-coding downstream 31328 7552837 ~ 7553209 (-)
G17950 NA non-coding upstream 408 7586506 ~ 7588473 (-)
G18141 NA non-coding upstream 142025 7728123 ~ 7737484 (-)
G18171 NA non-coding upstream 212932 7799030 ~ 7799626 (-)
G17911 NA other downstream 331283 7251311 ~ 7267952 (-)
CI01000001_06932075_06937182 NA other downstream 647314 6931621 ~ 6937231 (-)
G17789 NA other downstream 694123 6837525 ~ 6890414 (-)
G16753 NA other downstream 968948 6583054 ~ 6615589 (-)
G16664 NA other downstream 1236582 6344104 ~ 6347955 (-)
G18023 NA other upstream 170403 7756501 ~ 7757520 (-)
G18223 NA other upstream 340006 7926104 ~ 7928517 (-)
CI01000001_09804494_09811219 NA other upstream 2223559 9804429 ~ 9811219 (-)
G20136 NA other upstream 2952929 10539027 ~ 10539850 (-)
CI01000001_10862471_10864514 NA other upstream 3276127 10862225 ~ 10865770 (-)

Expression


Co-expression Network