G24386


Basic Information

Item Value
gene id G24386
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056701.1
NCBI id CM032070.1
chromosome length 30200998
location 29312729 ~ 29318597 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU36355
ttacttagggaacgcataaaaaattactctttttgagtctatcgaggagatggctgcattaaggtaagcgatctacggggtagcctctgactaagacctggactagcccagatgtgtcgtgagtctgttctggccaaacaaggtctctaagcgacccagactcctaacgaacgataagtcgaaactaggaaatattatagttaattaatgatccaaa

Function

GO:

id name namespace
GO:0043254 regulation of protein-containing complex assembly biological_process
GO:0044087 regulation of cellular component biogenesis biological_process
GO:0051128 regulation of cellular component organization biological_process
GO:0010638 positive regulation of organelle organization biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0008154 actin polymerization or depolymerization biological_process
GO:1902903 regulation of supramolecular fiber organization biological_process
GO:1902905 positive regulation of supramolecular fiber organization biological_process
GO:0090066 regulation of anatomical structure size biological_process
GO:0051493 regulation of cytoskeleton organization biological_process
GO:0051495 positive regulation of cytoskeleton organization biological_process
GO:0031334 positive regulation of protein-containing complex assembly biological_process
GO:0032956 regulation of actin cytoskeleton organization biological_process
GO:0007010 cytoskeleton organization biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0007015 actin filament organization biological_process
GO:0032970 regulation of actin filament-based process biological_process
GO:0051258 protein polymerization biological_process
GO:0097435 supramolecular fiber organization biological_process
GO:0034314 Arp2/3 complex-mediated actin nucleation biological_process
GO:0030832 regulation of actin filament length biological_process
GO:0030833 regulation of actin filament polymerization biological_process
GO:0030838 positive regulation of actin filament polymerization biological_process
GO:0030029 actin filament-based process biological_process
GO:0033043 regulation of organelle organization biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0030036 actin cytoskeleton organization biological_process
GO:0030041 actin filament polymerization biological_process
GO:0045010 actin nucleation biological_process
GO:0110053 regulation of actin filament organization biological_process
GO:0008064 regulation of actin polymerization or depolymerization biological_process
GO:0032535 regulation of cellular component size biological_process
GO:0032271 regulation of protein polymerization biological_process
GO:0032273 positive regulation of protein polymerization biological_process
GO:0016503 pheromone receptor activity molecular_function

KEGG:

id description
ko05130 Pathogenic Escherichia coli infection
ko05131 Shigellosis

RNA

RNA id representative length rna type GC content exon number start site end site
TU36355 True 217 lncRNA 0.42 2 29312729 29318597

Neighbor

gene id symbol gene type direction distance location
pycr1a pycr1a,pycr1,LOC107732146,LOC107675279,LOC107717481,LOC107671247,LOC107571301,LOC107552109 coding upstream 21285 29288138 ~ 29291444 (+)
LOC122335289 myadml2,LOC107671249,LOC107675441,LOC107717480,LOC107571305,LOC107552108,LOC107732151 coding upstream 25547 29284692 ~ 29287182 (+)
notum1a notum,notum1a,LOC107732149,LOC107671240,LOC108438914 coding upstream 28991 29274653 ~ 29283738 (+)
LOC122335520 LOC107675901,LOC107732152 coding upstream 84643 29224992 ~ 29228086 (+)
LOC122334787 NA coding upstream 87650 29215127 ~ 29225079 (+)
LOC122335371 LOC107758342 coding downstream 2751 29321348 ~ 29324920 (+)
LOC122334720 LOC107570416,LOC107685875,LOC107749047,LOC107728228 coding downstream 372710 29691307 ~ 29725107 (+)
LOC122334671 LOC107563545 coding downstream 455288 29773885 ~ 29785104 (+)
LOC122341412 NA coding downstream 597656 29916253 ~ 29921491 (+)
G24359 NA non-coding upstream 40411 29272032 ~ 29272318 (+)
G24317 LOC107732144,LOC107572667,LOC107674215,LOC107571308,LOC107571307,LOC107674125,LOC107671260,LOC107732141 non-coding upstream 108920 29195090 ~ 29203809 (+)
G24286 NA non-coding upstream 171152 29131163 ~ 29141577 (+)
G24278 NA non-coding upstream 186663 29120746 ~ 29126066 (+)
G24270 NA non-coding upstream 294226 29009482 ~ 29018503 (+)
G24398 LOC107575850 non-coding downstream 29138 29347735 ~ 29348652 (+)
G24406 NA non-coding downstream 44954 29363551 ~ 29363768 (+)
G24438 LOC105357980 non-coding downstream 181921 29500518 ~ 29501330 (+)
LOC122335675 NA non-coding downstream 407597 29726194 ~ 29746875 (+)
G24464 NA non-coding downstream 496022 29814619 ~ 29815647 (+)
LOC122335232 LOC107677928 other upstream 6489 29298708 ~ 29306240 (+)
cenpx stra13,LOC107676172,LOC107689848,LOC107732147,LOC107552128 other upstream 82498 29228716 ~ 29230231 (+)
LOC122335397 LOC107698766,LOC107717477,LOC107552107,LOC107671248,LOC107740236,LOC107556596 other upstream 238974 29060775 ~ 29073755 (+)
LOC122341401 NA other upstream 258315 29048278 ~ 29054414 (+)
LOC122334478 LOC107698777,LOC107556618,LOC107664385,LOC107568597,LOC797750,LOC107729209 other upstream 379645 28869079 ~ 28933084 (+)
LOC122335632 NA other downstream 73321 29391918 ~ 29402603 (+)
LOC122335508 LOC107717477,LOC107698766,LOC107552107,LOC107671248,LOC107740236 other downstream 121352 29439949 ~ 29442973 (+)
G24436 NA other downstream 180926 29499523 ~ 29500119 (+)

Expression


Co-expression Network