XLOC_006840 (eys)


Basic Information

Item Value
gene id XLOC_006840
gene name eys
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 37992158 ~ 38039871 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00013159
TTATATAAACTCTTTCCTTACATTCAGCATCTGAAAGAGAAACATATATGAATGCATGTGCTGCAAGTTGCCTTTGCGGTCACGGATACACCGGAGTCCACTGCGAACTTGACTTCTGCTCTGGACATCAGTGTTCAGAACACGCCGTCTGTGTGGACCAACAGCACAACTACACCTGTCGCTGCATGCTGGGATATGAGGGAACGCTCTGTGAGCTTGAGACAGATGAATGCAAAAGTGCGCCGTGCACCAATAATGCCACTTGCATTGATTTGGTGGCAGGATACCAATGCCTGTGTGCACCAGGATTTAAGGGTCGAACGTGCTCTGAGAGTATGAATGAGTGCTGGTCCAGACCCTGCAATAATGGAGGCTCCTGCATTGATCTGGTCAATGACTACATTTGTAACTGTCCACTAGGATTCACAGGACATGACTGCTCCATGCCGGCTACGGGCTGCACTTCCAACCCGTGCAACACAAAGGGCACTTCCATGTGCGAAGAGCAGCAGGATGGTTTTAAGTGCGTATGTCACCATGGCTATACGGGCCTGTTTTGTGAAACGTCCATCAATCACTGCGTCGAGGGATTGTGTCATCACGGATCAGAATGCGTGGATCTCACTAAAGGCTTCATGTGTGAATGTTTGCCTGGGTTACGAGGACGATTGTGCGAGGTAAACATTGATGACTGTCTGGA

Function

symbol description
eys Predicted to enable Notch binding activity. Acts upstream of or within several processes, including photoreceptor cell development; photoreceptor cell maintenance; and visual perception. Predicted to be located in several cellular components, including cilium; extracellular region; and interphotoreceptor matrix. Is expressed in brain; eye; gonad; liver; and muscle. Used to study cone-rod dystrophy. Human ortholog(s) of this gene implicated in retinitis pigmentosa 25. Orthologous to human EYS (eyes shut homolog).

GO:

id name namespace
GO:0050896 response to stimulus biological_process
GO:0046549 retinal cone cell development biological_process
GO:0045494 photoreceptor cell maintenance biological_process
GO:0035845 photoreceptor cell outer segment organization biological_process
GO:0007015 actin filament organization biological_process
GO:0007601 visual perception biological_process
GO:0042995 cell projection cellular_component
GO:0033165 interphotoreceptor matrix cellular_component
GO:0005856 cytoskeleton cellular_component
GO:0005576 extracellular region cellular_component
GO:0005929 cilium cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005112 Notch binding molecular_function
GO:0005509 calcium ion binding molecular_function

KEGG:

id description
ko04990 Domain-containing proteins not elsewhere classified

ZFIN:

id description
ZDB-GENE-130530-959 Predicted to enable Notch binding activity. Acts upstream of or within several processes, including photoreceptor cell development; photoreceptor cell maintenance; and visual perception. Predicted to be located in several cellular components, including cilium; extracellular region; and interphotoreceptor matrix. Is expressed in brain; eye; gonad; liver; and muscle. Used to study cone-rod dystrophy. Human ortholog(s) of this gene implicated in retinitis pigmentosa 25. Orthologous to human EYS (eyes shut homolog).

Ensembl:

ensembl_id ENSDARG00000079519

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00013159 True 700 mRNA 0.49 5 37992158 38039871

Neighbor

gene id symbol gene type direction distance location
XLOC_006839 si:dkey-188i13.11 coding downstream 335468 37650673 ~ 37656690 (-)
XLOC_006838 si:dkey-188i13.10 coding downstream 342563 37645572 ~ 37649595 (-)
XLOC_006837 si:dkey-188i13.9 coding downstream 349257 37638758 ~ 37642901 (-)
XLOC_006836 NA coding downstream 355560 37632626 ~ 37636598 (-)
XLOC_006835 ifi46 coding downstream 361066 37623276 ~ 37631092 (-)
XLOC_006841 CT027676.1 coding upstream 44206 38084077 ~ 38088627 (-)
XLOC_006842 NA coding upstream 150650 38190521 ~ 38195214 (-)
XLOC_006843 NA coding upstream 573354 38613225 ~ 38619719 (-)
XLOC_006844 lmbrd1 coding upstream 581646 38621517 ~ 38792061 (-)
XLOC_006845 BX323574.2 coding upstream 758174 38798045 ~ 38870801 (-)
XLOC_006471 BX537274.2 misc downstream 27727253 10264741 ~ 10264905 (-)
XLOC_006338 rn7sk misc downstream 37165933 825904 ~ 826225 (-)
XLOC_006829 NA non-coding downstream 456373 37528161 ~ 37535785 (-)
XLOC_006819 AL845493.1 non-coding downstream 813442 37178602 ~ 37178716 (-)
XLOC_006817 NA non-coding downstream 881622 37110212 ~ 37110536 (-)
XLOC_006815 NA non-coding downstream 979922 37009812 ~ 37012236 (-)
XLOC_006846 BX323574.1 non-coding upstream 813266 38853137 ~ 38853252 (-)
XLOC_006848 BX324188.2 non-coding upstream 1202684 39242555 ~ 39242672 (-)
XLOC_006850 NA non-coding upstream 1459721 39499592 ~ 39504493 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000012_04209791_04237026 NA coding CI01000012 null 4209026 ~ 4237160 (+)