G17385


Basic Information

Item Value
gene id G17385
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 9028681 ~ 9028951 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU19510
AAAGCGACGAGAATATTTTTGGTGCGCCAAAAAAACCCAAAATAACTTATTTAGTGATGGCCGATTTCAAAACACTGCTTCAGGAAGCTTCGGAGCATAATGAATCAGCGTATCGAATCATGATTCGGATCGCGTGTCAAACCGCCAAACTGCTGAAATCACGTGACTTTGGCGCTCTGAACCGCTGATTCGACACGCTGATTCATTATGCTCCGAAGCTTTCTGAAGCAGTGTTTTGAAACTATATAAGTCGTTATTTTGTTTTTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU19510 True 271 lncRNA 0.42 1 9028681 9028951

Neighbor

gene id symbol gene type direction distance location
CI01000001_08971649_08984224 NA coding upstream 44442 8970545 ~ 8984239 (+)
CI01000001_08962231_08968219 CASP9 coding upstream 60454 8962231 ~ 8968227 (+)
CI01000001_08950041_08960737 NA coding upstream 67610 8950041 ~ 8961071 (+)
CI01000001_08934325_08940532 KLHL21 coding upstream 87327 8934007 ~ 8941354 (+)
CI01000001_08841482_08845223 OLFML3A coding upstream 183048 8840862 ~ 8845633 (+)
CI01000001_09039724_09045754 NA coding downstream 10773 9039724 ~ 9046115 (+)
CI01000001_09059083_09101251 NA coding downstream 29913 9058864 ~ 9101352 (+)
CI01000001_09113045_09130978 NA coding downstream 84094 9113045 ~ 9131322 (+)
CI01000001_09132867_09145278 PA2G4.L, PA2G4-B, PA2G4B, PA2G4, PA2G4A coding downstream 103916 9132867 ~ 9145555 (+)
CI01000001_09147684_09162673 ESYT1A coding downstream 118733 9147684 ~ 9163215 (+)
G17359 NA non-coding upstream 162 9028111 ~ 9028519 (+)
G17495 NA non-coding upstream 17551 9010918 ~ 9011130 (+)
G17483 NA non-coding upstream 104937 8923496 ~ 8923744 (+)
G17479 NA non-coding upstream 108981 8919493 ~ 8919700 (+)
G17476 NA non-coding upstream 112279 8916173 ~ 8916402 (+)
G17388 NA non-coding downstream 59591 9088542 ~ 9091385 (+)
G17507 NA non-coding downstream 114410 9143361 ~ 9143834 (+)
G17326 NA non-coding downstream 184505 9213456 ~ 9273959 (+)
CI01000001_09308544_09311741 NA non-coding downstream 235565 9306701 ~ 9312011 (+)
G17234 NA other upstream 996198 8032124 ~ 8032483 (+)
CI01000001_07531945_07539781 NA other upstream 1488095 7531541 ~ 7540586 (+)
G15995 NA other upstream 3313730 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 3738725 5279837 ~ 5287698 (+)
G15794 NA other upstream 3963977 5061218 ~ 5064704 (+)
G17353 NA other downstream 187071 9216022 ~ 9228859 (+)
G17354 NA other downstream 205512 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 389377 9435836 ~ 9436373 (+)
G18896 NA other downstream 1210949 10239900 ~ 10241492 (+)
G18873 NA other downstream 1228161 10223879 ~ 10260714 (+)

Expression


Co-expression Network