G18876


Basic Information

Item Value
gene id G18876
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 10390688 ~ 10391598 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU21194
GTGCTAACAGGACTTCAAGCAGCAAAAAAGTGATGCCCCTTTAAAAACGTCTACAATATGAAAACAAAGATCTTCGAGAACAGCAACGATAAATCAACATTCAAAGCGATATGAACTCGATCTGCCTCACTGACAGTGTCTGTGCTGAGACAGCTCGAGCTCCAACTCCGCCAACTGCTCTCTAACCTCTTTCGGTAGAGCTGCCAAATCCACACCGCGGTCTGCCATCGCTGCGAGAATACGCTGAAGTTGTTTTAAGTGTGAAGAAATGCGCTTCGAAAGCCAAAAATCCTCCCGTCAAGACAGAAGACATGAATTAAAAGGTGAGTAACAATCCATCCGGACAACTACTCCTTCCGCCATGCTGTGAGAACTCACCAACTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU21194 True 384 lncRNA 0.46 2 10390688 10391598

Neighbor

gene id symbol gene type direction distance location
CI01000001_10328133_10329110 NA coding upstream 61578 10328040 ~ 10329110 (+)
CI01000001_10321783_10325266 NA coding upstream 65383 10321647 ~ 10325305 (+)
CI01000001_10150798_10152858 MIPA coding upstream 237750 10150373 ~ 10152938 (+)
CI01000001_10141190_10146911 PTGES3, PTGES3A coding upstream 242630 10141190 ~ 10148058 (+)
CI01000001_10093069_10104108 RND1B, RND1, RND1A coding upstream 284989 10092902 ~ 10105699 (+)
CI01000001_10395420_10396473 NA coding downstream 3253 10394851 ~ 10396705 (+)
CI01000001_10420931_10426716 NA coding downstream 28720 10420318 ~ 10427147 (+)
CI01000001_10525795_10530510 WNT1 coding downstream 131664 10523262 ~ 10530543 (+)
CI01000001_10538498_10539667 RPS26 coding downstream 146790 10538388 ~ 10539846 (+)
CI01000001_10573770_10582123 LMBR1L coding downstream 182172 10573770 ~ 10582238 (+)
G18878 NA non-coding upstream 46567 10340037 ~ 10344121 (+)
G18880 NA non-coding upstream 52539 10336887 ~ 10338149 (+)
G18874 NA non-coding upstream 54772 10284763 ~ 10335916 (+)
G18884 NA non-coding upstream 70613 10304931 ~ 10320075 (+)
G18902 NA non-coding upstream 138034 10252108 ~ 10252654 (+)
G18882 NA non-coding downstream 10632 10402230 ~ 10403910 (+)
G18951 NA non-coding downstream 40359 10431957 ~ 10433760 (+)
G18967 NA non-coding downstream 42621 10434219 ~ 10434542 (+)
G18968 NA non-coding downstream 44172 10435770 ~ 10435995 (+)
G18969 NA non-coding downstream 45055 10436653 ~ 10436873 (+)
G18872 NA other upstream 109319 10271146 ~ 10281369 (+)
G18873 NA other upstream 129974 10223879 ~ 10260714 (+)
G18896 NA other upstream 149196 10239900 ~ 10241492 (+)
CI01000001_09435836_09436037 NA other upstream 952625 9435836 ~ 9436373 (+)
G17354 NA other upstream 1150011 9234463 ~ 9240677 (+)
G18937 NA other downstream 83386 10474984 ~ 10476389 (+)
G19039 NA other downstream 459326 10850924 ~ 10853983 (+)
G19314 NA other downstream 1109596 11501194 ~ 11558673 (+)

Expression


Co-expression Network