G19080


Basic Information

Item Value
gene id G19080
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 10814390 ~ 10815702 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU21423
GTCGCTCCAGCGGCCTCGTTCAAATTTAATTACAAATATGCTTAGATTTTAGAAGGGTTGTGAAACATATAGCATTAAAAAAAAAGATCCTCTGGGAGAAAGATTGGAACCACTGAATTAGAGTATCATTCCGACTGTACAGAGATAACGATATTAGCAATCCAACTAGAGCAGCCCCAGTGAAACAAGATATTGAGTACATAATATAATTGAGATCGAAACTACCTAATTAGATTTGTGTATTTATCTGCTTTAATAATCATGTTTACTACATCCTTTAATTATGCTTTCCAAAGCTCAGGGGCTGTATAAAAACAGCAAACCAGTATCCCGTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU21423 True 336 lncRNA 0.27 2 10814390 10815702

Neighbor

gene id symbol gene type direction distance location
CI01000001_10749174_10779222 ARHGEF25A coding upstream 34936 10749174 ~ 10779454 (+)
CI01000001_10715529_10716091 NA coding upstream 97480 10715114 ~ 10716910 (+)
CI01000001_10694664_10713151 NA coding upstream 99706 10694467 ~ 10714684 (+)
CI01000001_10688354_10691353 NA coding upstream 122981 10687862 ~ 10691409 (+)
CI01000001_10604980_10633286 KMT2D coding upstream 180850 10603888 ~ 10633540 (+)
CI01000001_10856786_10861403 C1GALT1A coding downstream 40258 10855960 ~ 10862138 (+)
CI01000001_10968536_10981345 NA coding downstream 152642 10968344 ~ 10981787 (+)
CI01000001_10989337_10992917 BIRC5B coding downstream 173635 10989337 ~ 10992978 (+)
CI01000001_11019871_11028065 MYL6, MYL6B coding downstream 203777 11019479 ~ 11028524 (+)
CI01000001_11099313_11137500 HUWE1 coding downstream 283611 11099313 ~ 11138278 (+)
G18998 NA non-coding upstream 157119 10655387 ~ 10657271 (+)
G19041 NA non-coding upstream 159468 10654569 ~ 10654922 (+)
G18997 NA non-coding upstream 215139 10599026 ~ 10599251 (+)
G19008 NA non-coding upstream 215576 10598604 ~ 10598814 (+)
G19009 NA non-coding upstream 228096 10585956 ~ 10586294 (+)
G19087 NA non-coding downstream 58280 10873982 ~ 10874233 (+)
G19088 NA non-coding downstream 58968 10874670 ~ 10874871 (+)
G19034 NA non-coding downstream 76735 10892437 ~ 10896905 (+)
G19130 NA non-coding downstream 109826 10925528 ~ 10986466 (+)
G19121 NA non-coding downstream 255202 11070904 ~ 11126159 (+)
CI01000001_10538498_10539667 RPS26 other upstream 274544 10538388 ~ 10539846 (+)
G18937 NA other upstream 338001 10474984 ~ 10476389 (+)
CI01000001_10395420_10396473 NA other upstream 417685 10394851 ~ 10396705 (+)
G18872 NA other upstream 533021 10271146 ~ 10281369 (+)
G18873 NA other upstream 553676 10223879 ~ 10260714 (+)
G19039 NA other downstream 35222 10850924 ~ 10853983 (+)
G19314 NA other downstream 685492 11501194 ~ 11558673 (+)
G19395 NA other downstream 865620 11681322 ~ 11681817 (+)
CI01000001_13514115_13517063 NA other downstream 2697702 13514115 ~ 13517063 (+)

Expression


Co-expression Network