G19088


Basic Information

Item Value
gene id G19088
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 10874670 ~ 10874871 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU21431
GTACACATATACAATGACAATAATGCCTGTAAATATACAACTACGATTAGAGTTGTCTGCATAAAATGCCTTGTGAACATTCACACGTTTGCCCTGTGATAAATTTATTTCCATAAATACTATTTTCTCAATTCTGCGCATATATTTTCACTTACCTACATCAATTGCTCCATCAGTATGATCACTACATATTTTACGATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU21431 True 202 lncRNA 0.40 1 10874670 10874871

Neighbor

gene id symbol gene type direction distance location
CI01000001_10856786_10861403 C1GALT1A coding upstream 12532 10855960 ~ 10862138 (+)
CI01000001_10807407_10818870 SLC26A10 coding upstream 54617 10807320 ~ 10820053 (+)
CI01000001_10749174_10779222 ARHGEF25A coding upstream 95216 10749174 ~ 10779454 (+)
CI01000001_10715529_10716091 NA coding upstream 157760 10715114 ~ 10716910 (+)
CI01000001_10694664_10713151 NA coding upstream 159986 10694467 ~ 10714684 (+)
CI01000001_10968536_10981345 NA coding downstream 93473 10968344 ~ 10981787 (+)
CI01000001_10989337_10992917 BIRC5B coding downstream 114466 10989337 ~ 10992978 (+)
CI01000001_11019871_11028065 MYL6, MYL6B coding downstream 144608 11019479 ~ 11028524 (+)
CI01000001_11099313_11137500 HUWE1 coding downstream 224442 11099313 ~ 11138278 (+)
CI01000001_11138617_11139541 NA coding downstream 263414 11138285 ~ 11139673 (+)
G19087 NA non-coding upstream 437 10873982 ~ 10874233 (+)
G19080 NA non-coding upstream 58968 10814390 ~ 10815702 (+)
G18998 NA non-coding upstream 217399 10655387 ~ 10657271 (+)
G19041 NA non-coding upstream 219748 10654569 ~ 10654922 (+)
G18997 NA non-coding upstream 275419 10599026 ~ 10599251 (+)
G19034 NA non-coding downstream 17566 10892437 ~ 10896905 (+)
G19130 NA non-coding downstream 50657 10925528 ~ 10986466 (+)
G19121 NA non-coding downstream 196033 11070904 ~ 11126159 (+)
G19226 NA non-coding downstream 294422 11169293 ~ 11183770 (+)
G19096 NA non-coding downstream 380198 11255069 ~ 11304024 (+)
G19039 NA other upstream 20687 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 334824 10538388 ~ 10539846 (+)
G18937 NA other upstream 398281 10474984 ~ 10476389 (+)
CI01000001_10395420_10396473 NA other upstream 477965 10394851 ~ 10396705 (+)
G18872 NA other upstream 593301 10271146 ~ 10281369 (+)
G19314 NA other downstream 626323 11501194 ~ 11558673 (+)
G19395 NA other downstream 806451 11681322 ~ 11681817 (+)
CI01000001_13514115_13517063 NA other downstream 2638533 13514115 ~ 13517063 (+)

Expression


Co-expression Network