G19469


Basic Information

Item Value
gene id G19469
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 11907617 ~ 11967369 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU21883
TTATATATATATATATATATATATATATATATATATATATATAACAATTTTGTATTGTAAAATCAATTATGTATGTTTTTAATTGGTTCACCTGACAGGTCCTGCCATTAAGACCCCAGTGATGCAAGTTAGGAGACCAACAGAGGCCACGGCCATCTGATGGTCGCTTCCGGACTGCCAGATGAGTCGAGCGTTCTCCACGGCCTCTTCCGGAAGAAGACCCACCAGATCGTCCCACATCATTTTGCCCTCATCAGTCTTGCTTTCGCTATCGTTTTGGAGAGCACGTTTAGGCGGGGCGACTCCTCTGCTTAAGGTCTGCGTGACAGAGGGGGCCGCATCTCCAGATCCAGACAAAGCCACAGCTACAAGGAAGGCACAGGCGAGAAACGCAAGGACTCTGAGCAAGATCAACCAGGCCGGCGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU21883 True 426 lncRNA 0.47 2 11907617 11967369

Neighbor

gene id symbol gene type direction distance location
CI01000001_11898621_11898914 NA coding upstream 7429 11898297 ~ 11900188 (+)
CI01000001_11809724_11812692 LZIC coding upstream 94173 11809427 ~ 11813444 (+)
CI01000001_11756218_11760009 NA coding upstream 146120 11756161 ~ 11761497 (+)
CI01000001_11656975_11660666 TARDBPL, TARDBP coding upstream 245751 11656029 ~ 11661866 (+)
CI01000001_11440491_11445508 NA coding upstream 462077 11439979 ~ 11445540 (+)
CI01000001_11990189_11991073 AURKAIP1 coding downstream 20708 11988077 ~ 11991195 (+)
CI01000001_11994138_12003906 NA coding downstream 26769 11994138 ~ 12004100 (+)
CI01000001_12006266_12048809 DVL1A, DVL1B, DVL1 coding downstream 38559 12005928 ~ 12049045 (+)
CI01000001_12058281_12060612 NA coding downstream 90386 12057755 ~ 12061261 (+)
CI01000001_12088244_12091260 NA coding downstream 120798 12088167 ~ 12091494 (+)
G19490 NA non-coding upstream 19107 11888104 ~ 11888510 (+)
G19489 NA non-coding upstream 19734 11887468 ~ 11887883 (+)
G19488 NA non-coding upstream 20416 11886948 ~ 11887201 (+)
G19438 NA non-coding upstream 31365 11852354 ~ 11876252 (+)
G19435 NA non-coding upstream 76494 11830532 ~ 11831123 (+)
G19512 NA non-coding downstream 24663 11992032 ~ 11992375 (+)
G19473 NA non-coding downstream 87559 12054928 ~ 12055598 (+)
G19538 NA non-coding downstream 142194 12109563 ~ 12481405 (+)
G19548 NA non-coding downstream 176251 12143620 ~ 12144142 (+)
G19621 NA non-coding downstream 337644 12305013 ~ 12369030 (+)
G19395 NA other upstream 225800 11681322 ~ 11681817 (+)
G19314 NA other upstream 348944 11501194 ~ 11558673 (+)
G19039 NA other upstream 1053634 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 1367771 10538388 ~ 10539846 (+)
G18937 NA other upstream 1431228 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 1546035 13514115 ~ 13517063 (+)

Expression


Co-expression Network