G21600


Basic Information

Item Value
gene id G21600
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000002
NCBI id null
chromosome length 1907571
location 954904 ~ 955193 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU24263
GTAATTAACAGCAGTGTAATGCGAGTTACGTAATCAGGTTACTTTTTTCCAAGTAACCAAGTAACTAGTAAAGTAAAGCCTTAAATTTATAGTTTTTTTTTGTTTGTTTTTTTCAAGAAACTAGTAAAGCATTAAATTTACAGCAACATATCTGAGTTGAACATGATGTTTATTGTAGTTCTAAACTAAATGTGAGCATGCATTTATTTTCTGCAATCCAGAATGGCAGCGCAGCTGAAAGGTCTGTTTGAGTTGCGCCCTCTGCTGTACAGGAGTGAATTTGCATTTCC

Function

NR:

description
PREDICTED: dihydroxyacetone phosphate acyltransferase

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU24263 True 290 lncRNA 0.28 1 954904 955193

Neighbor

gene id symbol gene type direction distance location
CI01000002_00772164_00786566 TNNT2, TNNT2A coding upstream 168338 772164 ~ 786566 (+)
CI01000002_00738127_00744469 TNNI1A, TNNI1B, TNNI1 coding upstream 210149 738127 ~ 744755 (+)
CI01000002_00718489_00718872 PHLDA3 coding upstream 235403 718222 ~ 719501 (+)
CI01000002_00699406_00707935 CSRP1, CSRP1A, CSRP1B coding upstream 246599 699057 ~ 708305 (+)
CI01000002_00470438_00473433 NA coding upstream 480336 470438 ~ 474568 (+)
CI01000002_01017365_01040978 NA coding downstream 61996 1017189 ~ 1041687 (+)
CI01000002_01047128_01076568 NA coding downstream 91775 1046968 ~ 1076571 (+)
CI01000002_01103311_01128430 LGR6 coding downstream 148118 1103311 ~ 1128805 (+)
CI01000002_01154239_01172018 NA coding downstream 198318 1153511 ~ 1172865 (+)
CI01000002_01257892_01258637 NA coding downstream 302524 1257717 ~ 1258637 (+)
G21593 NA non-coding upstream 11218 943434 ~ 943686 (+)
G21592 NA non-coding upstream 12331 942286 ~ 942573 (+)
G21591 NA non-coding upstream 14288 938651 ~ 940616 (+)
G21589 NA non-coding upstream 17403 937196 ~ 937501 (+)
G21578 NA non-coding upstream 40335 914352 ~ 914569 (+)
G21603 NA non-coding downstream 3610 958803 ~ 959087 (+)
G21605 NA non-coding downstream 5422 960615 ~ 974163 (+)
G21607 NA non-coding downstream 34246 989439 ~ 991677 (+)
G21610 NA non-coding downstream 40846 996039 ~ 996242 (+)
G21612 NA non-coding downstream 44819 1000012 ~ 1000245 (+)
G21272 NA other upstream 429107 523007 ~ 525797 (+)
G21254 NA other upstream 474449 479147 ~ 480455 (+)
G21239 NA other upstream 490988 463555 ~ 463916 (+)
G21930 NA other downstream 432421 1387614 ~ 1409057 (+)

Expression


Co-expression Network