G21612


Basic Information

Item Value
gene id G21612
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000002
NCBI id null
chromosome length 1907571
location 1000012 ~ 1000245 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU24289
CGTAATCGAGCTGAATGACACACAACAGAAGCGCTCTCTCGCATGCTCTCTCTCTCTCTGTCACGCGCGCGATCAGTTCTCCTTGCGCCTGAATAGTCAAATACACGCGCACACAGATGTCGTGGAGTATCTCGCGTGAATACAGTCGGTTATGGCTTAAGTGGACGTAAACAGGTGGGTAAAAAACTGAATATGTGTCAGTATATTACGTCCATGCATTCAGCAGCCCCTAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU24289 True 234 lncRNA 0.43 1 1000012 1000245

Neighbor

gene id symbol gene type direction distance location
CI01000002_00772164_00786566 TNNT2, TNNT2A coding upstream 213446 772164 ~ 786566 (+)
CI01000002_00738127_00744469 TNNI1A, TNNI1B, TNNI1 coding upstream 255257 738127 ~ 744755 (+)
CI01000002_00718489_00718872 PHLDA3 coding upstream 280511 718222 ~ 719501 (+)
CI01000002_00699406_00707935 CSRP1, CSRP1A, CSRP1B coding upstream 291707 699057 ~ 708305 (+)
CI01000002_00470438_00473433 NA coding upstream 525444 470438 ~ 474568 (+)
CI01000002_01017365_01040978 NA coding downstream 16944 1017189 ~ 1041687 (+)
CI01000002_01047128_01076568 NA coding downstream 46723 1046968 ~ 1076571 (+)
CI01000002_01103311_01128430 LGR6 coding downstream 103066 1103311 ~ 1128805 (+)
CI01000002_01154239_01172018 NA coding downstream 153266 1153511 ~ 1172865 (+)
CI01000002_01257892_01258637 NA coding downstream 257472 1257717 ~ 1258637 (+)
G21610 NA non-coding upstream 3770 996039 ~ 996242 (+)
G21607 NA non-coding upstream 8335 989439 ~ 991677 (+)
G21605 NA non-coding upstream 25849 960615 ~ 974163 (+)
G21603 NA non-coding upstream 40925 958803 ~ 959087 (+)
G21600 NA non-coding upstream 44819 954904 ~ 955193 (+)
G21674 NA non-coding downstream 129223 1129468 ~ 1130441 (+)
G21697 NA non-coding downstream 132668 1132913 ~ 1144177 (+)
G21702 NA non-coding downstream 162215 1162460 ~ 1162881 (+)
G21713 NA non-coding downstream 199431 1199676 ~ 1199884 (+)
G21714 NA non-coding downstream 200572 1200817 ~ 1201074 (+)
G21272 NA other upstream 474215 523007 ~ 525797 (+)
G21254 NA other upstream 519557 479147 ~ 480455 (+)
G21239 NA other upstream 536096 463555 ~ 463916 (+)
G21930 NA other downstream 387369 1387614 ~ 1409057 (+)

Expression


Co-expression Network