G21716


Basic Information

Item Value
gene id G21716
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000002
NCBI id null
chromosome length 1907571
location 1204543 ~ 1204919 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU24426
GTAATTTTTAATTACACATAGTGGACCGGATGTGGTAGGTTTATGAGATTATGAGATGGTTTAATTTAGTTGTTTAATTATTTAATAATAGGATTATGCACGGATGAAAATCTAACAAAAATCTAGTTTATGTTACTTATGTTTTCAGAGAAACTGTTATCTCATTCATTTCATTCAAGTTAGGTAACTTTTATAACAATCTGTTCCCCCCATAAATCTAGCAAACACTGAAGCACTAAAAATGAAACTCATTGGCTGAATCTCACAAAACCTGCGAAGAACCTGACTGAATCATATTTCACCACAAAATAAATAGAAAAATATAGACTTTTTTCGCTTTAGGGAAATGGTGCCTATTTTAACACCATTAACATTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU24426 True 377 lncRNA 0.36 1 1204543 1204919

Neighbor

gene id symbol gene type direction distance location
CI01000002_01154239_01172018 NA coding upstream 31678 1153511 ~ 1172865 (+)
CI01000002_01103311_01128430 LGR6 coding upstream 75738 1103311 ~ 1128805 (+)
CI01000002_01047128_01076568 NA coding upstream 127972 1046968 ~ 1076571 (+)
CI01000002_01017365_01040978 NA coding upstream 162856 1017189 ~ 1041687 (+)
CI01000002_00772164_00786566 TNNT2, TNNT2A coding upstream 417977 772164 ~ 786566 (+)
CI01000002_01257892_01258637 NA coding downstream 52798 1257717 ~ 1258637 (+)
CI01000002_01474926_01477596 NGFA coding downstream 270007 1474926 ~ 1477913 (+)
CI01000002_01546448_01547246 NA coding downstream 341529 1546448 ~ 1547474 (+)
CI01000002_01650177_01674596 UHRF1BP1 coding downstream 445258 1650177 ~ 1674657 (+)
CI01000002_01755342_01805760 NA coding downstream 549549 1754468 ~ 1805772 (+)
G21714 NA non-coding upstream 3469 1200817 ~ 1201074 (+)
G21713 NA non-coding upstream 4659 1199676 ~ 1199884 (+)
G21702 NA non-coding upstream 41662 1162460 ~ 1162881 (+)
G21697 NA non-coding upstream 60366 1132913 ~ 1144177 (+)
G21674 NA non-coding upstream 74102 1129468 ~ 1130441 (+)
G21727 NA non-coding downstream 29031 1233950 ~ 1234229 (+)
G21728 NA non-coding downstream 29656 1234575 ~ 1234788 (+)
G21729 NA non-coding downstream 30319 1235238 ~ 1235492 (+)
G21738 NA non-coding downstream 43579 1248498 ~ 1248732 (+)
G21739 NA non-coding downstream 44313 1249232 ~ 1249500 (+)
G21272 NA other upstream 678746 523007 ~ 525797 (+)
G21254 NA other upstream 724088 479147 ~ 480455 (+)
G21239 NA other upstream 740627 463555 ~ 463916 (+)
G21930 NA other downstream 182695 1387614 ~ 1409057 (+)

Expression


Co-expression Network