G21943


Basic Information

Item Value
gene id G21943
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000002
NCBI id null
chromosome length 1907571
location 1428964 ~ 1429392 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU24721
TTTCTAATAATTGCTCCCACAGTTGATTTCTTCACACCAAGCTGCTTACCTATTGCAGATTCAGTCTTCCCAGCCTGGTGCAGGTCTACAAATTTTGTTTCTGGTGTCCTTTGACAGCTCTTTGGTCTTGGCCATAGTGGAGTTTGGAGTCTGACTGTTTGAGGTTGTGGACAGGTGTCTTTTATACTGATAACGAGTTCAAACAGGTGCCATTAATACAGGTAACGAGTGGAGGACAGAGGAGCCTCTTAAAGAAGAAGTTACAGGTCTGTGAGAGCCAGAAATCTTGCTTTTTTGTAGGTGACCAAATACTTATTTTACAAAGAAATTTACCAATTAATTCATTAAAAATCCTACAATGTAATTTCCTGGATTCTTTCCCCCATTCTGTCTCTCATAGTTGAAGTGTACCTATGATGAAAATTACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU24721 True 429 lncRNA 0.29 1 1428964 1429392

Neighbor

gene id symbol gene type direction distance location
CI01000002_01257892_01258637 NA coding upstream 170327 1257717 ~ 1258637 (+)
CI01000002_01154239_01172018 NA coding upstream 256099 1153511 ~ 1172865 (+)
CI01000002_01103311_01128430 LGR6 coding upstream 300159 1103311 ~ 1128805 (+)
CI01000002_01047128_01076568 NA coding upstream 352393 1046968 ~ 1076571 (+)
CI01000002_01017365_01040978 NA coding upstream 387277 1017189 ~ 1041687 (+)
CI01000002_01474926_01477596 NGFA coding downstream 45534 1474926 ~ 1477913 (+)
CI01000002_01546448_01547246 NA coding downstream 117056 1546448 ~ 1547474 (+)
CI01000002_01650177_01674596 UHRF1BP1 coding downstream 220785 1650177 ~ 1674657 (+)
CI01000002_01755342_01805760 NA coding downstream 325076 1754468 ~ 1805772 (+)
CI01000002_01821988_01829384 ANKS1A coding downstream 392364 1821756 ~ 1829430 (+)
G21942 NA non-coding upstream 688 1427935 ~ 1428276 (+)
G21927 NA non-coding upstream 42438 1386289 ~ 1386526 (+)
G21922 NA non-coding upstream 47626 1381129 ~ 1381338 (+)
G21921 NA non-coding upstream 48014 1380680 ~ 1380950 (+)
G21919 NA non-coding upstream 49207 1379348 ~ 1379757 (+)
G21945 NA non-coding downstream 3733 1433125 ~ 1433334 (+)
G21946 NA non-coding downstream 3977 1433369 ~ 1433612 (+)
G22022 NA non-coding downstream 55670 1485062 ~ 1485316 (+)
G22048 NA non-coding downstream 93030 1522422 ~ 1522715 (+)
G22067 NA non-coding downstream 157351 1586743 ~ 1646258 (+)
G21930 NA other upstream 19907 1387614 ~ 1409057 (+)
G21272 NA other upstream 903167 523007 ~ 525797 (+)
G21254 NA other upstream 948509 479147 ~ 480455 (+)
G21239 NA other upstream 965048 463555 ~ 463916 (+)

Expression


Co-expression Network