G172804 (zgc:100846,cunh9orf72,LOC107556919,LOC107747573,LOC107733782,LOC107695028,LOC107585223)


Basic Information

Item Value
gene id G172804
gene name zgc:100846,cunh9orf72,LOC107556919,LOC107747573,LOC107733782,LOC107695028,LOC107585223
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NW_025047686.1
NCBI id JAEQBD010000031.1
chromosome length 1000000
location 512574 ~ 513327 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU256068
TCGCAAAATCTCGCCGTTCAGCGTGTGATTGGCCAGAAACGTGACCTCTCCGTCGCTGAGCAGCGACAACCCCTGACCTCTGGGGGCCCAGATGTGCTGTACACGAGGTCCCAGGATGTTGTCCCAGTAAGCGAAGGTCGCGGCCAACACGGGACACCAGTCCTCGACCAGCACTTCAGTCTTAGCCACGCCGGGAGACTGCGGGGGACAGGCTGCAGACATGACGGCCGCTCTCACAGACCTAGTCACTCTAGTCGGTCTCACAATGCAGAAGTCAGTGGTGACAAACAGATTGCAACATCCCCCTGCTGTTACACTGCGCCCATGCAATCTGCTGCTTCGGCTCGAAACAACAACACATTCGTCAACCCTTTTCCTGGCTTCCTGCTGTCATTAGGCTCAAGGCTGCGAAGAAGCGAGCTGCTGAAGCG

Function

symbol description
zgc:100846 Predicted to enable guanyl-nucleotide exchange factor activity. Acts upstream of or within several processes, including swimming; swimming behavior; and thigmotaxis. Predicted to be active in autophagosome and endosome. Is expressed in several structures, including central nervous system; heart; integument; liver; and pleuroperitoneal region. Used to study amyotrophic lateral sclerosis. Human ortholog(s) of this gene implicated in frontotemporal dementia and/or amyotrophic lateral sclerosis-1. Orthologous to human C9orf72 (C9orf72-SMCR8 complex subunit).

NR:

description
PREDICTED: protein C9orf72-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU256068 True 431 lncRNA 0.58 2 512574 513327

Neighbor

gene id symbol gene type direction distance location
LOC122332165 nccrp1,LOC107548479,LOC107757518,LOC107693441,LOC107596142,LOC107700228,LOC107746425 coding upstream 33707 476421 ~ 478867 (+)
LOC122332182 melk,LOC107702285,LOC107709443,LOC107750464 coding upstream 47511 433795 ~ 465063 (+)
LOC122332221 mark3a,LOC107721219,LOC107698147,LOC107582486 coding upstream 56444 446410 ~ 456130 (+)
LOC122332218 LOC107589543,LOC107708428,LOC107678525,LOC107721219,LOC107698147 coding upstream 68122 441763 ~ 444452 (+)
LOC122332211 kcng3,LOC107756869,LOC107590001,LOC107758134,LOC107586474,LOC108273984 coding upstream 222343 284894 ~ 290231 (+)
LOC122332199 LOC107747572,LOC107666443,LOC107556922 coding downstream 33827 547154 ~ 548637 (+)
LOC122332204 adh8b,LOC107747567,LOC107666442,LOC107747568,LOC107733735,LOC107695031,LOC107585225,LOC107666441 coding downstream 53132 566459 ~ 574866 (+)
LOC122332186 metap1,LOC107556924,LOC107747566,LOC107695030,LOC107733733,LOC107666440 coding downstream 144790 658117 ~ 667257 (+)
LOC122332170 eif4e,LOC107585229,LOC107747571,LOC107556921 coding downstream 177288 690615 ~ 698060 (+)
LOC122332167 LOC107666555,LOC107556920,LOC107747569,LOC107733787,LOC107585221,LOC107695029 coding downstream 183542 696869 ~ 718734 (+)
G172777 NA non-coding upstream 59274 441054 ~ 453300 (+)
G172755 NA non-coding upstream 161036 293647 ~ 351538 (+)
G172733 NA non-coding upstream 453136 59199 ~ 59438 (+)
G172723 NA non-coding upstream 477243 34860 ~ 35331 (+)
G172784 adh8a,LOC107666441,LOC107747568,LOC107695031,LOC107733735,LOC107585225,LOC108263479 non-coding downstream 40437 553764 ~ 687206 (+)
G172800 NA non-coding downstream 156036 669363 ~ 672910 (+)
G172794 NA non-coding downstream 211900 725227 ~ 725907 (+)
G172737 NA other upstream 30542 465438 ~ 482032 (+)
G172778 mark3a,LOC107721219 other upstream 56494 446541 ~ 456080 (+)
LOC122332175 ppm1ba,LOC107733761,LOC107585253,LOC107747533,LOC107666482,LOC107602505,LOC107698745 other downstream 276125 789452 ~ 811855 (+)

Expression


Co-expression Network