G22434



Basic Information


Item Value
gene id G22434
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 207583 ~ 207922 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25296
AGTTGAATAAATGTTTCATTGTCATATTTTGTCATGCTTTGTGTGTTCTGCTTTATGTGTCCACCCCGTCATGTGCTGGTCCACCCTGTCATCTTGATATTTTAAAATAATATTTTAAATAATAATTCAATCATACCTATATAATCCAGTGTGTTCAATAGCTGGGTGTGGGGGCAATAACATGCAAACAAAAAACTGCATCCAAATATCACAGTTTTCTCAAAATAAGAAAAAATACATGTGCAAATTGTATGAGTTTCTTTAAAAACACATAATTTGCATAAAATCTTTTATGTATTTATAATTTGAAAGCAAACAAATAACCCTGTTTAGGAAAGGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU25296 True 340 lncRNA 0.31 1 207583 207922
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00157111_00159800 NA coding upstream 47339 156863 ~ 160244 (+)
CI01000003_00011191_00013812 NA coding upstream 193685 11191 ~ 13898 (+)
CI01000003_00007611_00010967 NA coding upstream 196616 7611 ~ 10967 (+)
CI01000003_00266342_00275005 NA coding downstream 58420 266342 ~ 275312 (+)
CI01000003_00323130_00336023 CLDN15LA coding downstream 114945 322867 ~ 336168 (+)
CI01000003_00355244_00360638 SAGA coding downstream 147322 355244 ~ 360793 (+)
CI01000003_00380494_00385991 PROC, PROCA coding downstream 172572 380494 ~ 386091 (+)
CI01000003_00390997_00406970 WDR33 coding downstream 182975 390622 ~ 408312 (+)
G22433 NA non-coding upstream 311 206981 ~ 207272 (+)
G22432 NA non-coding upstream 897 206369 ~ 206686 (+)
G22394 NA non-coding upstream 47123 137893 ~ 160460 (+)
G22396 NA non-coding upstream 60878 145858 ~ 146705 (+)
G22339 NA non-coding upstream 170965 33154 ~ 36618 (+)
G22435 NA non-coding downstream 4260 212182 ~ 213447 (+)
G22436 NA non-coding downstream 6347 214269 ~ 214693 (+)
G22437 NA non-coding downstream 8690 216612 ~ 218340 (+)
G22438 NA non-coding downstream 11725 219647 ~ 219859 (+)
G22441 NA non-coding downstream 14091 222013 ~ 222783 (+)
G22420 NA other upstream 18144 179531 ~ 189439 (+)
G22578 NA other downstream 716881 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 1655346 1862854 ~ 1868137 (+)
G23870 NA other downstream 2072738 2280660 ~ 2285641 (+)

Expression


G22434 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G22434 Expression in each Bioproject

Bar chart with 34 bars.
G22434 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network