G22436



Basic Information


Item Value
gene id G22436
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 214269 ~ 214693 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25298
GCAAACTCTAGAGAGGAGTGATAACTCTGTGCATGATGTCTCCTGAACATGCTCCTGAGAACTGCTGCCCTGGTTTCAAAACCCAGTTTAGTCACAGGGTCATATGCAATCAAAACCTGAGGAATGAGGCATCCCTGTGATGGAACACAAAGTGTTTCATTAGCACATTTTGCTCATCACATGCCACTGGCCAAGGAGAAGGTGAACCCTGAATATACCATATGTCTCACAGAACCATCAATTAGACAAAATGTCAGTGTTGCAAGATTCATATGAAATCGGTGCAGTAAGAGTGGATGCATGCTACACAAATGATCAAGAATATTGTTCTTTCCACTTTTGACCAGATGTGATATCTAATGCAGTCCAAAGGTTGGAAATTTAAATCTGAAAGCTTTATGATTTGGGAAAAGTGTAAAACAAAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25298 True 425 lncRNA 0.48 1 214269 214693

Neighbor


gene id symbol gene type direction distance location
CI01000003_00157111_00159800 NA coding upstream 54025 156863 ~ 160244 (+)
CI01000003_00011191_00013812 NA coding upstream 200371 11191 ~ 13898 (+)
CI01000003_00007611_00010967 NA coding upstream 203302 7611 ~ 10967 (+)
CI01000003_00266342_00275005 NA coding downstream 51649 266342 ~ 275312 (+)
CI01000003_00323130_00336023 CLDN15LA coding downstream 108174 322867 ~ 336168 (+)
CI01000003_00355244_00360638 SAGA coding downstream 140551 355244 ~ 360793 (+)
CI01000003_00380494_00385991 PROC, PROCA coding downstream 165801 380494 ~ 386091 (+)
CI01000003_00390997_00406970 WDR33 coding downstream 176204 390622 ~ 408312 (+)
G22435 NA non-coding upstream 822 212182 ~ 213447 (+)
G22434 NA non-coding upstream 6347 207583 ~ 207922 (+)
G22433 NA non-coding upstream 6997 206981 ~ 207272 (+)
G22432 NA non-coding upstream 7583 206369 ~ 206686 (+)
G22394 NA non-coding upstream 53809 137893 ~ 160460 (+)
G22437 NA non-coding downstream 1919 216612 ~ 218340 (+)
G22438 NA non-coding downstream 4954 219647 ~ 219859 (+)
G22441 NA non-coding downstream 7320 222013 ~ 222783 (+)
G22447 NA non-coding downstream 12437 227130 ~ 229997 (+)
G22439 NA non-coding downstream 27096 241789 ~ 243643 (+)
G22420 NA other upstream 24830 179531 ~ 189439 (+)
G22578 NA other downstream 710110 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 1648575 1862854 ~ 1868137 (+)
G23870 NA other downstream 2065967 2280660 ~ 2285641 (+)

Expression


G22436 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G22436 Expression in each Bioproject

Bar chart with 6 bars.
G22436 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network