G22474



Basic Information


Item Value
gene id G22474
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 306992 ~ 307226 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25345
CTCACGCACTGGAATAAACCTGTAGGACCTGTTTGAAAATTACGGTTGCATGAGATTTATGAAACTATATGAAACTATGTAAAAACAGAAGGAGGTGAGTCCCTTTGTAAGAGGAGGTGTGTTAAATTAGCCCTATATGTGTTAATTATGATCGAGAGAGTTAAATTATTTGAAATTGTATTTTGCACTGCCTTGAAGTGTGCATGTTTTAGGAATGTGATATCTAAGATTAAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25345 True 235 lncRNA 0.36 1 306992 307226
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00266342_00275005 NA coding upstream 31680 266342 ~ 275312 (+)
CI01000003_00157111_00159800 NA coding upstream 146748 156863 ~ 160244 (+)
CI01000003_00011191_00013812 NA coding upstream 293094 11191 ~ 13898 (+)
CI01000003_00007611_00010967 NA coding upstream 296025 7611 ~ 10967 (+)
CI01000003_00323130_00336023 CLDN15LA coding downstream 15641 322867 ~ 336168 (+)
CI01000003_00355244_00360638 SAGA coding downstream 48018 355244 ~ 360793 (+)
CI01000003_00380494_00385991 PROC, PROCA coding downstream 73268 380494 ~ 386091 (+)
CI01000003_00390997_00406970 WDR33 coding downstream 83671 390622 ~ 408312 (+)
CI01000003_00413809_00414819 NA coding downstream 105364 412590 ~ 415156 (+)
G22472 NA non-coding upstream 2363 304383 ~ 304629 (+)
G22468 NA non-coding upstream 10019 296055 ~ 296973 (+)
G22422 NA non-coding upstream 15227 291102 ~ 291765 (+)
G22421 NA non-coding upstream 16288 290470 ~ 290704 (+)
G22425 NA non-coding upstream 29997 276057 ~ 276995 (+)
G22475 NA non-coding downstream 404 307630 ~ 307847 (+)
G22480 NA non-coding downstream 5271 312497 ~ 312705 (+)
G22481 NA non-coding downstream 5569 312795 ~ 313016 (+)
G22483 NA non-coding downstream 8349 315575 ~ 315803 (+)
G22484 NA non-coding downstream 9520 316746 ~ 317024 (+)
G22420 NA other upstream 117553 179531 ~ 189439 (+)
G22578 NA other downstream 617577 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 1556042 1862854 ~ 1868137 (+)
G23870 NA other downstream 1973434 2280660 ~ 2285641 (+)

Expression


G22474 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G22474 Expression in each Bioproject

Bar chart with 11 bars.
G22474 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network