G22506



Basic Information


Item Value
gene id G22506
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 372551 ~ 372819 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25391
GAGATACTTTACCAGTGTGCTGGTTTGATCCATGGCTGGCCTACTGAAACTTTTTATCCAGCAAAGTTATATTTTTAACCATCTTAAAGATCCTGCTGCTTCACTAGCAAGACATTCCATAGGTTTTGCTGGTGAATCATACGGATACTGTATAAAAGCACCTAATCTTTTTTATATAAATAAAGCTCTACATTATTATTAATGAGATTTTACATCAACTCATTAAACTGATTGTTATTTCACAGCAACAGGAAAATTGAACAGTAAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25391 True 269 lncRNA 0.33 1 372551 372819
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00355244_00360638 SAGA coding upstream 11758 355244 ~ 360793 (+)
CI01000003_00323130_00336023 CLDN15LA coding upstream 36383 322867 ~ 336168 (+)
CI01000003_00266342_00275005 NA coding upstream 97239 266342 ~ 275312 (+)
CI01000003_00157111_00159800 NA coding upstream 212307 156863 ~ 160244 (+)
CI01000003_00011191_00013812 NA coding upstream 358653 11191 ~ 13898 (+)
CI01000003_00380494_00385991 PROC, PROCA coding downstream 7675 380494 ~ 386091 (+)
CI01000003_00390997_00406970 WDR33 coding downstream 18078 390622 ~ 408312 (+)
CI01000003_00413809_00414819 NA coding downstream 39771 412590 ~ 415156 (+)
CI01000003_00431473_00447759 MFN1A coding downstream 58654 431473 ~ 447950 (+)
CI01000003_00538178_00547944 PHB2, PHB2A, PHB2B coding downstream 165266 538085 ~ 547983 (+)
G22501 NA non-coding upstream 15737 356555 ~ 356814 (+)
G22419 NA non-coding upstream 47029 324681 ~ 325522 (+)
G22484 NA non-coding upstream 55527 316746 ~ 317024 (+)
G22483 NA non-coding upstream 56748 315575 ~ 315803 (+)
G22481 NA non-coding upstream 59535 312795 ~ 313016 (+)
G22488 NA non-coding downstream 37744 410563 ~ 411612 (+)
G22490 NA non-coding downstream 77729 450548 ~ 451101 (+)
G22524 NA non-coding downstream 95854 468673 ~ 468902 (+)
G22544 NA non-coding downstream 149330 522149 ~ 522653 (+)
G22420 NA other upstream 183112 179531 ~ 189439 (+)
G22578 NA other downstream 551984 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 1490449 1862854 ~ 1868137 (+)
G23870 NA other downstream 1907841 2280660 ~ 2285641 (+)

Expression


G22506 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G22506 Expression in each Bioproject

Bar chart with 5 bars.
G22506 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network