G22490



Basic Information


Item Value
gene id G22490
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 450548 ~ 451101 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25373
AAGCACATCCATCTATCATAAAAGTAATCCATACAGCTCCAAGTGGTTAATAAAAATAAATAAATTTTTAAGAAAAATATCCATATTTATAAATCTTTATAGACTATAATCACTAGCATCCTGTAACGTCCGTCCGCGTGTTCATGAGAGATTCGAGTTACGGTGTATGACGTAGGATGTAGGAGTAGCGTAAGCTTAGGTGAGAGTAGACTCCTCTCGCAGTTCAAACAAATAGGGCTGAGCAACAAACTCAAGCTCCTCTGACGTTTTCTCTTTAAAAATTCTCATTTTAGACTTCTAATTCATGACCGATGTTTTGTTTTGCTCTATCCTCTGTGCTTCCAGGTTCATCAAAACGTCATGCATCAGGTCAAAGTCAACTATTTTGCCAGAATCGACTGTCGGAAGTCAGTGATTCTAGTTTATAAAAAGTTATAAAAAATATGCATGTTTTTCTTACAAAACACATCGCTTCGTTTCAGAAGACCTTTATTAACCCCCTGGAGCCATATGGATTACTTTTATGATGGATGGATGATTTTTTTGGGCTTTAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25373 True 554 lncRNA 0.39 1 450548 451101
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00431473_00447759 MFN1A coding upstream 2598 431473 ~ 447950 (+)
CI01000003_00413809_00414819 NA coding upstream 35392 412590 ~ 415156 (+)
CI01000003_00390997_00406970 WDR33 coding upstream 42236 390622 ~ 408312 (+)
CI01000003_00380494_00385991 PROC, PROCA coding upstream 64457 380494 ~ 386091 (+)
CI01000003_00355244_00360638 SAGA coding upstream 89755 355244 ~ 360793 (+)
CI01000003_00538178_00547944 PHB2, PHB2A, PHB2B coding downstream 86984 538085 ~ 547983 (+)
CI01000003_00568546_00573291 NA coding downstream 117445 568546 ~ 573869 (+)
CI01000003_00596144_00607951 NA coding downstream 145043 596144 ~ 608038 (+)
CI01000003_00644619_00663181 NA coding downstream 192554 643655 ~ 663280 (+)
CI01000003_00665762_00716862 DLG1, DLG1L coding downstream 213860 664961 ~ 717379 (+)
G22488 NA non-coding upstream 38936 410563 ~ 411612 (+)
G22506 NA non-coding upstream 77729 372551 ~ 372819 (+)
G22501 NA non-coding upstream 93734 356555 ~ 356814 (+)
G22419 NA non-coding upstream 125026 324681 ~ 325522 (+)
G22524 NA non-coding downstream 17572 468673 ~ 468902 (+)
G22544 NA non-coding downstream 71048 522149 ~ 522653 (+)
G22551 NA non-coding downstream 109819 560920 ~ 561612 (+)
G22585 NA non-coding downstream 130967 582068 ~ 582405 (+)
G22583 NA non-coding downstream 293580 744681 ~ 744938 (+)
G22420 NA other upstream 261109 179531 ~ 189439 (+)
G22578 NA other downstream 473702 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 1412167 1862854 ~ 1868137 (+)
G23870 NA other downstream 1829559 2280660 ~ 2285641 (+)

Expression


G22490 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G22490 Expression in each Bioproject

Bar chart with 18 bars.
G22490 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network