G22544


Basic Information

Item Value
gene id G22544
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 522149 ~ 522653 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU25429
TTTATGTTCAGCCGCAATTGTGACCGGTAGAATAATGTGTAACGTTACGTTATACTGAAAATATAGCCTATCAGCCCAGTTATTTAACACATTTTAAACTCTTTCATATCATTTTAGGGTTACTATTAAACATAAATACAACCATCTGTTGTTTTGTTGTGTGGTTAGCACTTTTCATTGCAGGGAACCATTTCAGTTGTCTATCGGGATCCTTAGGAATATGATAAAATGATTTCCCCTTTGCTTTCCCCCGCCTGTTCTAGCATCCTGGCGCACAGCAGCTGTCCACCATGTTGAAATAATAAGGTTTGTAAGGTCTAAACATGTCTGGTTTTAAATTATTGTTCGACCACTATCGATACCAATGCTACAGCCGCTCTAGCACTCTCCTGATGGCCTGCCAAAATGGCGGAGTTTGGATTGCATGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU25429 True 429 lncRNA 0.42 2 522149 522653
Loading

Neighbor

gene id symbol gene type direction distance location
CI01000003_00431473_00447759 MFN1A coding upstream 74199 431473 ~ 447950 (+)
CI01000003_00413809_00414819 NA coding upstream 106993 412590 ~ 415156 (+)
CI01000003_00390997_00406970 WDR33 coding upstream 113837 390622 ~ 408312 (+)
CI01000003_00380494_00385991 PROC, PROCA coding upstream 136058 380494 ~ 386091 (+)
CI01000003_00355244_00360638 SAGA coding upstream 161356 355244 ~ 360793 (+)
CI01000003_00538178_00547944 PHB2, PHB2A, PHB2B coding downstream 15432 538085 ~ 547983 (+)
CI01000003_00568546_00573291 NA coding downstream 45893 568546 ~ 573869 (+)
CI01000003_00596144_00607951 NA coding downstream 73491 596144 ~ 608038 (+)
CI01000003_00644619_00663181 NA coding downstream 121002 643655 ~ 663280 (+)
CI01000003_00665762_00716862 DLG1, DLG1L coding downstream 142308 664961 ~ 717379 (+)
G22524 NA non-coding upstream 53247 468673 ~ 468902 (+)
G22490 NA non-coding upstream 71048 450548 ~ 451101 (+)
G22488 NA non-coding upstream 110537 410563 ~ 411612 (+)
G22506 NA non-coding upstream 149330 372551 ~ 372819 (+)
G22551 NA non-coding downstream 38267 560920 ~ 561612 (+)
G22585 NA non-coding downstream 59415 582068 ~ 582405 (+)
G22583 NA non-coding downstream 222028 744681 ~ 744938 (+)
G22574 NA non-coding downstream 295145 817798 ~ 819540 (+)
G22601 NA non-coding downstream 356978 879631 ~ 879868 (+)
G22420 NA other upstream 332710 179531 ~ 189439 (+)
G22578 NA other downstream 402150 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 1340615 1862854 ~ 1868137 (+)
G23870 NA other downstream 1758007 2280660 ~ 2285641 (+)

Expression

G22544 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G22544 Expression in each Bioproject

Bar chart with 34 bars.
G22544 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network