G22601



Basic Information


Item Value
gene id G22601
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 879631 ~ 879868 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25508
GGAGAGAGTTTATATACAAAGTGCTGATGAGGGAGTGCAGGTGTCGGGAATCCATGATGATGAGCTGACTGGTGCAGGTGTGGGTCAGATGGAATTATGGGAAATGGAGTTCGGGGACGGTGAGACAGATGGTGACAGTGACATTACTCCCCCCTCCCGGTAGGCGCGACCTCGCGTCGTAGATAGATAACCGGGAGAGAGGGTGGGCGTCCTGGAGACGTGATGGGTGCTGCAGGGT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU25508 True 238 lncRNA 0.56 1 879631 879868
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00842413_00868623 TNK2 coding upstream 10968 842413 ~ 868663 (+)
CI01000003_00747650_00802075 NA coding upstream 76950 746547 ~ 802681 (+)
CI01000003_00731635_00742538 TFR1A coding upstream 137022 731200 ~ 742609 (+)
CI01000003_00665762_00716862 DLG1, DLG1L coding upstream 162252 664961 ~ 717379 (+)
CI01000003_00644619_00663181 NA coding upstream 216351 643655 ~ 663280 (+)
CI01000003_00981851_01059504 TMTOPSA coding downstream 101983 981851 ~ 1059504 (+)
CI01000003_01126525_01129929 ADIPOQB coding downstream 246230 1126098 ~ 1130325 (+)
CI01000003_01140472_01168860 NA coding downstream 260474 1140342 ~ 1168900 (+)
CI01000003_01258265_01259530 NA coding downstream 378397 1258265 ~ 1259551 (+)
CI01000003_01280201_01309764 NA coding downstream 399899 1279767 ~ 1310125 (+)
G22574 NA non-coding upstream 60091 817798 ~ 819540 (+)
G22583 NA non-coding upstream 134693 744681 ~ 744938 (+)
G22585 NA non-coding upstream 297226 582068 ~ 582405 (+)
G22551 NA non-coding upstream 318019 560920 ~ 561612 (+)
G22544 NA non-coding upstream 356978 522149 ~ 522653 (+)
G22602 NA non-coding downstream 85 879953 ~ 880262 (+)
G22603 NA non-coding downstream 753 880621 ~ 880871 (+)
G22605 NA non-coding downstream 2737 882605 ~ 882932 (+)
G22615 NA non-coding downstream 16253 896121 ~ 896329 (+)
G22625 NA non-coding downstream 33666 913534 ~ 913794 (+)
CI01000003_00390997_00406970 WDR33 other upstream 484417 390622 ~ 408312 (+)
G22420 NA other upstream 690192 179531 ~ 189439 (+)
G22578 NA other downstream 44935 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 983400 1862854 ~ 1868137 (+)
G23870 NA other downstream 1400792 2280660 ~ 2285641 (+)

Expression


G22601 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G22601 Expression in each Bioproject

Bar chart with 8 bars.
G22601 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network