G22602



Basic Information


Item Value
gene id G22602
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 879953 ~ 880262 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25509
GGCGGGTCGGGAGTCTCCTTAAGTCCAGTGGCCTTAGCCCAATTCCCCGGCTCGGCCACTAAATTCAGGGAGCGGGCTCGTGGAGGACTGGAGCAGGCTCTGGCGCGGAGGCTGGAGCGGGCTCTCGGAGTGGAGTGGTTGCTGGAATGGTGGCGGACTTCAGCGCTGACCTCACTGATTTAATCATAGGGTCTGCCACCTTGGCTCCCAGGTCAGTGCTGTTGGAGACCCACTTCCTACTCCGGGGGAACACTGGCGGCCAGGAATGGACAGGACCGTTGAAGCGGTATGTGAAGGGATCCGGGGTGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25509 True 310 lncRNA 0.62 1 879953 880262
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00842413_00868623 TNK2 coding upstream 11290 842413 ~ 868663 (+)
CI01000003_00747650_00802075 NA coding upstream 77272 746547 ~ 802681 (+)
CI01000003_00731635_00742538 TFR1A coding upstream 137344 731200 ~ 742609 (+)
CI01000003_00665762_00716862 DLG1, DLG1L coding upstream 162574 664961 ~ 717379 (+)
CI01000003_00644619_00663181 NA coding upstream 216673 643655 ~ 663280 (+)
CI01000003_00981851_01059504 TMTOPSA coding downstream 101589 981851 ~ 1059504 (+)
CI01000003_01126525_01129929 ADIPOQB coding downstream 245836 1126098 ~ 1130325 (+)
CI01000003_01140472_01168860 NA coding downstream 260080 1140342 ~ 1168900 (+)
CI01000003_01258265_01259530 NA coding downstream 378003 1258265 ~ 1259551 (+)
CI01000003_01280201_01309764 NA coding downstream 399505 1279767 ~ 1310125 (+)
G22601 NA non-coding upstream 85 879631 ~ 879868 (+)
G22574 NA non-coding upstream 60413 817798 ~ 819540 (+)
G22583 NA non-coding upstream 135015 744681 ~ 744938 (+)
G22585 NA non-coding upstream 297548 582068 ~ 582405 (+)
G22551 NA non-coding upstream 318341 560920 ~ 561612 (+)
G22603 NA non-coding downstream 359 880621 ~ 880871 (+)
G22605 NA non-coding downstream 2343 882605 ~ 882932 (+)
G22615 NA non-coding downstream 15859 896121 ~ 896329 (+)
G22625 NA non-coding downstream 33272 913534 ~ 913794 (+)
G22641 NA non-coding downstream 48680 928942 ~ 929147 (+)
CI01000003_00390997_00406970 WDR33 other upstream 484739 390622 ~ 408312 (+)
G22420 NA other upstream 690514 179531 ~ 189439 (+)
G22578 NA other downstream 44541 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 983006 1862854 ~ 1868137 (+)
G23870 NA other downstream 1400398 2280660 ~ 2285641 (+)

Expression


G22602 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.2.
End of interactive chart.

G22602 Expression in each Bioproject

Bar chart with 14 bars.
G22602 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network