G22603



Basic Information


Item Value
gene id G22603
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 880621 ~ 880871 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25510
GTTGCAATCAAGGTGCGGATGCAGGATCAAGATAAGCAGCAAAGGTTTTATTAACAATACTTTAAACACTGGAACAGGAACAGGAGCAGAACAACTAACCATACAAAGATGAGAACAGACAAAGGAGTGCAGGAGGAGAGAGTCTATAAACGAAGTGCTGATGAGGGAGTGCAGGTGTCGGGAATCCATGAAGATGATCTGACTGGGTGCAGGTGTGGGTCAGAGAGGATTATGGGAAATGGAGTCCAGGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25510 True 251 lncRNA 0.46 1 880621 880871
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00842413_00868623 TNK2 coding upstream 11958 842413 ~ 868663 (+)
CI01000003_00747650_00802075 NA coding upstream 77940 746547 ~ 802681 (+)
CI01000003_00731635_00742538 TFR1A coding upstream 138012 731200 ~ 742609 (+)
CI01000003_00665762_00716862 DLG1, DLG1L coding upstream 163242 664961 ~ 717379 (+)
CI01000003_00644619_00663181 NA coding upstream 217341 643655 ~ 663280 (+)
CI01000003_00981851_01059504 TMTOPSA coding downstream 100980 981851 ~ 1059504 (+)
CI01000003_01126525_01129929 ADIPOQB coding downstream 245227 1126098 ~ 1130325 (+)
CI01000003_01140472_01168860 NA coding downstream 259471 1140342 ~ 1168900 (+)
CI01000003_01258265_01259530 NA coding downstream 377394 1258265 ~ 1259551 (+)
CI01000003_01280201_01309764 NA coding downstream 398896 1279767 ~ 1310125 (+)
G22602 NA non-coding upstream 359 879953 ~ 880262 (+)
G22601 NA non-coding upstream 753 879631 ~ 879868 (+)
G22574 NA non-coding upstream 61081 817798 ~ 819540 (+)
G22583 NA non-coding upstream 135683 744681 ~ 744938 (+)
G22585 NA non-coding upstream 298216 582068 ~ 582405 (+)
G22605 NA non-coding downstream 1734 882605 ~ 882932 (+)
G22615 NA non-coding downstream 15250 896121 ~ 896329 (+)
G22625 NA non-coding downstream 32663 913534 ~ 913794 (+)
G22641 NA non-coding downstream 48071 928942 ~ 929147 (+)
G23039 NA non-coding downstream 189419 1070290 ~ 1070508 (+)
CI01000003_00390997_00406970 WDR33 other upstream 485407 390622 ~ 408312 (+)
G22420 NA other upstream 691182 179531 ~ 189439 (+)
G22578 NA other downstream 43932 924803 ~ 925248 (+)
CI01000003_01863421_01867859 NA other downstream 982397 1862854 ~ 1868137 (+)
G23870 NA other downstream 1399789 2280660 ~ 2285641 (+)

Expression


G22603 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

G22603 Expression in each Bioproject

Bar chart with 10 bars.
G22603 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network