G22578



Basic Information


Item Value
gene id G22578
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 924803 ~ 925248 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU25485
CATCATTCAAGCATACCAAGCTGACCTGCTGAAGGACTTGGGCGATAGTGAGGAAGTGGGGGCTGATTTCATCCATGAGTTGCGTCAGTCAGCAGATTTAGCGCTCCGTGCCACCAAGGAGACGGCCAAGTCAATCGGCCGCTCTATGGCAGCCCTGGTGGCCACGGAGCGCCACCTCTGGCTAAATCTGTCTGACATTAAAGATCGTGACAAGACGTATCTCTTGGATGCCCCACTGAATCCGTCTGGCCTCTTTGGTGACGCTATCACATCTGTCACCAAGAGGTTTCAGGAGGCGAGGAAGCAGGCTGCTGCTATGCAGCAGTTTCTTCCTCGTCGTGCCCAAGTCCCTTCGGCTGCTGGGCGGGAACAGCCGAAGCCGAGTACGAGCTCCTCGCATCAGCACAGACAACAGCAGAAGCAGAGCGTTGCTACCTGCACTCCCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU25485 True 446 TUCP 0.56 1 924803 925248
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_00842413_00868623 TNK2 coding upstream 56140 842413 ~ 868663 (+)
CI01000003_00747650_00802075 NA coding upstream 122122 746547 ~ 802681 (+)
CI01000003_00731635_00742538 TFR1A coding upstream 182194 731200 ~ 742609 (+)
CI01000003_00665762_00716862 DLG1, DLG1L coding upstream 207424 664961 ~ 717379 (+)
CI01000003_00644619_00663181 NA coding upstream 261523 643655 ~ 663280 (+)
CI01000003_00981851_01059504 TMTOPSA coding downstream 56603 981851 ~ 1059504 (+)
CI01000003_01126525_01129929 ADIPOQB coding downstream 200850 1126098 ~ 1130325 (+)
CI01000003_01140472_01168860 NA coding downstream 215094 1140342 ~ 1168900 (+)
CI01000003_01258265_01259530 NA coding downstream 333017 1258265 ~ 1259551 (+)
CI01000003_01280201_01309764 NA coding downstream 354519 1279767 ~ 1310125 (+)
G22625 NA non-coding upstream 11009 913534 ~ 913794 (+)
G22615 NA non-coding upstream 28474 896121 ~ 896329 (+)
G22605 NA non-coding upstream 41871 882605 ~ 882932 (+)
G22603 NA non-coding upstream 43932 880621 ~ 880871 (+)
G22602 NA non-coding upstream 44541 879953 ~ 880262 (+)
G22641 NA non-coding downstream 3694 928942 ~ 929147 (+)
G23039 NA non-coding downstream 145042 1070290 ~ 1070508 (+)
G23056 NA non-coding downstream 251582 1176830 ~ 1222662 (+)
G23175 NA non-coding downstream 402315 1327563 ~ 1327875 (+)
G23217 NA non-coding downstream 420025 1345273 ~ 1345574 (+)
CI01000003_00390997_00406970 WDR33 other upstream 529589 390622 ~ 408312 (+)
G22420 NA other upstream 735364 179531 ~ 189439 (+)
CI01000003_01863421_01867859 NA other downstream 938020 1862854 ~ 1868137 (+)
G23870 NA other downstream 1355412 2280660 ~ 2285641 (+)

Expression


G22578 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G22578 Expression in each Bioproject

Bar chart with 36 bars.
G22578 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network