G23056



Basic Information


Item Value
gene id G23056
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1176830 ~ 1222662 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU26018
CGAACAATGCTAGGAAGATTGTTCCAGAGTTTAGGTGCCAAATAGGAGAAGGATCTACCACCTGCAGTTGATTTTGATATTCTAGGTATTACCAGCTGGCCTGAATTCTGAGATCGCAATAGACGTGAAGGACTATAATGAATTAGGAGCTCGCTCAGGTACTGGGGAGCTAAACCATTTAGTGCTTTGTAAGTAATTAGCAAGATTTTAAAATCTATACGATGTTTAACAGGAAGCCAATGCAGTGTTGACAGAACTGGGCTAATATGGTCATACTTCCTGGTTCTAGTAAGAACTCTAGCTGCTGCATTTTGTACGAGCTGTAGTTTATTTATCAGGCGAGCAGAACAACCACCCAGTAGAGCATTACAGTAATCTAGCCTTGAGGTCATGAACGCATGAACTAACTGTTCTGCATTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU26018 True 420 lncRNA 0.36 2 1176830 1222662
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_01140472_01168860 NA coding upstream 7930 1140342 ~ 1168900 (+)
CI01000003_01126525_01129929 ADIPOQB coding upstream 46505 1126098 ~ 1130325 (+)
CI01000003_00981851_01059504 TMTOPSA coding upstream 117326 981851 ~ 1059504 (+)
CI01000003_00842413_00868623 TNK2 coding upstream 308167 842413 ~ 868663 (+)
CI01000003_00747650_00802075 NA coding upstream 374149 746547 ~ 802681 (+)
CI01000003_01258265_01259530 NA coding downstream 35603 1258265 ~ 1259551 (+)
CI01000003_01280201_01309764 NA coding downstream 57105 1279767 ~ 1310125 (+)
CI01000003_01329453_01342093 NA coding downstream 106791 1329453 ~ 1342672 (+)
CI01000003_01356590_01360272 NA coding downstream 133815 1356477 ~ 1360348 (+)
CI01000003_01382733_01410162 MIB1 coding downstream 159786 1382448 ~ 1410190 (+)
G23039 NA non-coding upstream 106322 1070290 ~ 1070508 (+)
G22641 NA non-coding upstream 247683 928942 ~ 929147 (+)
G22625 NA non-coding upstream 263036 913534 ~ 913794 (+)
G22615 NA non-coding upstream 280501 896121 ~ 896329 (+)
G22605 NA non-coding upstream 293898 882605 ~ 882932 (+)
G23175 NA non-coding downstream 104901 1327563 ~ 1327875 (+)
G23217 NA non-coding downstream 122611 1345273 ~ 1345574 (+)
G23223 NA non-coding downstream 155397 1378059 ~ 1378355 (+)
G23242 NA non-coding downstream 263520 1486182 ~ 1486398 (+)
G23244 NA non-coding downstream 281887 1504549 ~ 1504981 (+)
G22578 NA other upstream 251582 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 781616 390622 ~ 408312 (+)
G22420 NA other upstream 987391 179531 ~ 189439 (+)
CI01000003_01863421_01867859 NA other downstream 640606 1862854 ~ 1868137 (+)
G23870 NA other downstream 1057998 2280660 ~ 2285641 (+)

Expression


G23056 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G23056 Expression in each Bioproject

Bar chart with 43 bars.
G23056 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network