G23379



Basic Information


Item Value
gene id G23379
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1953337 ~ 1953707 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU26378
CCAAAACTCACACTCCAAAACTAACCACCCTGCTCCGAGTCGGTCTCGAACCCCCTGAATGCACTACCAATGACGCTAAACACCACATTCTCTAGCTGTGTGCAGTAGTTTAACTGCAAAACTCTCACCATCTGGCCACTGTTACACACGCAATGCGAGTGGATGTCTGTTTATCACAGCTGACGCACAACAAAATGCTTCACAAAAAATAAAGCGCAGATGATGAACGAACGACAAGGAAGCACAAAAAATGAACATACAGTACAAAAGAGTAAATACAAACAAGTTTGTTGTTAATCGCGAAAACGAAACAGCAGCTCCAGACAATCAAAACCCAGTGTTACTTACATGATAAGGAATCAAAGCAGGCC

Function


NR:

description
PREDICTED: protocadherin Fat 3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU26378 True 371 lncRNA 0.43 1 1953337 1953707
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_01921110_01928830 TXNDC12 coding upstream 23716 1920837 ~ 1929621 (+)
CI01000003_01907347_01909263 NA coding upstream 43737 1907122 ~ 1909600 (+)
CI01000003_01893593_01901539 SCHIP1 coding upstream 51568 1893593 ~ 1901769 (+)
CI01000003_01889537_01891879 NA coding upstream 61266 1889498 ~ 1892071 (+)
CI01000003_01863421_01867859 NA coding upstream 85409 1862854 ~ 1868137 (+)
CI01000003_01956459_01966449 SLC25A24L coding downstream 2694 1956401 ~ 1966455 (+)
CI01000003_01969544_01973134 COPE coding downstream 15623 1969330 ~ 1973134 (+)
CI01000003_01982406_01992219 NA coding downstream 28629 1982336 ~ 1992844 (+)
CI01000003_02070747_02072861 NA coding downstream 117040 2070747 ~ 2073389 (+)
CI01000003_02101903_02151773 NA coding downstream 147108 2100815 ~ 2151976 (+)
G23323 NA non-coding upstream 94123 1858488 ~ 1859214 (+)
G23322 NA non-coding upstream 95836 1855877 ~ 1857501 (+)
G23326 NA non-coding upstream 98169 1854305 ~ 1855168 (+)
G23346 NA non-coding upstream 101659 1851281 ~ 1851678 (+)
G23318 NA non-coding upstream 104268 1839845 ~ 1849069 (+)
G23383 NA non-coding downstream 25322 1979029 ~ 1979593 (+)
G23356 NA non-coding downstream 75825 2029532 ~ 2047851 (+)
G23770 NA non-coding downstream 185581 2139288 ~ 2139544 (+)
G23771 NA non-coding downstream 185838 2139545 ~ 2139868 (+)
G23787 NA non-coding downstream 246987 2200694 ~ 2200936 (+)
G22578 NA other upstream 1028089 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 1558123 390622 ~ 408312 (+)
G22420 NA other upstream 1763898 179531 ~ 189439 (+)
G23870 NA other downstream 326953 2280660 ~ 2285641 (+)

Expression


G23379 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G23379 Expression in each Bioproject

Bar chart with 42 bars.
G23379 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network