G23383


Basic Information

Item Value
gene id G23383
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1979029 ~ 1979593 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU26384
GTTAATTGTATGGCAAAGTAGAATTTCTCACACCAGTGTACCTTGAATTTTATTCATAGAAATCACTTGATCTATGTCGTGGTATTGGAAAAAAAATTCTTTGAGAGAAATTAGGCTGTTTATGCTTGGGAACAGGGATTTACGCGGGGCTGACAGATTGATTATTAGGCGTGTATTACCCTAGAATTTCCTAGCAGCCACTCCAATAGGGCTAATATGGAAAATCTCAAAGGGGGGAAGCATTAAAAGGGCTAATCATGAAACCTGATTCGACTTCTTTTTTAATCAGATTGTCTACTATATCGGGCTCTGCTAGAGCAGATTGGCGATTATCACAGACAATGTTTTGAGAGAGCGAGGGTTAATTTGAGGACATGGTGGAATGAGCCACTCAACAGAAGTCTGTTGTATATATACCTATTATCAAAGCTATGAATAAACTTAATATCACAACTCACTGTGTGAGAAATTTGATCACTAATTTTCTAGAGAACTGCCACTAGGGGGTGCCAAACTATACAACTATACAAAACTATACAAGCAACAAGTAAACTTTGAGCAGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU26384 True 565 lncRNA 0.35 1 1979029 1979593
Loading

Neighbor

gene id symbol gene type direction distance location
CI01000003_01969544_01973134 COPE coding upstream 5895 1969330 ~ 1973134 (+)
CI01000003_01956459_01966449 SLC25A24L coding upstream 12574 1956401 ~ 1966455 (+)
CI01000003_01921110_01928830 TXNDC12 coding upstream 49408 1920837 ~ 1929621 (+)
CI01000003_01907347_01909263 NA coding upstream 69429 1907122 ~ 1909600 (+)
CI01000003_01893593_01901539 SCHIP1 coding upstream 77260 1893593 ~ 1901769 (+)
CI01000003_01982406_01992219 NA coding downstream 2743 1982336 ~ 1992844 (+)
CI01000003_02070747_02072861 NA coding downstream 91154 2070747 ~ 2073389 (+)
CI01000003_02101903_02151773 NA coding downstream 121222 2100815 ~ 2151976 (+)
CI01000003_02175343_02190917 ST6GALNAC5, ST6GALNAC5A coding downstream 195197 2174790 ~ 2193320 (+)
CI01000003_02259112_02344710 AK5 coding downstream 279519 2259112 ~ 2344710 (+)
G23379 NA non-coding upstream 25322 1953337 ~ 1953707 (+)
G23323 NA non-coding upstream 119815 1858488 ~ 1859214 (+)
G23322 NA non-coding upstream 121528 1855877 ~ 1857501 (+)
G23326 NA non-coding upstream 123861 1854305 ~ 1855168 (+)
G23346 NA non-coding upstream 127351 1851281 ~ 1851678 (+)
G23356 NA non-coding downstream 49939 2029532 ~ 2047851 (+)
G23770 NA non-coding downstream 159695 2139288 ~ 2139544 (+)
G23771 NA non-coding downstream 159952 2139545 ~ 2139868 (+)
G23787 NA non-coding downstream 221101 2200694 ~ 2200936 (+)
G23789 NA non-coding downstream 227512 2207105 ~ 2207635 (+)
CI01000003_01863421_01867859 NA other upstream 110892 1862854 ~ 1868137 (+)
G22578 NA other upstream 1053781 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 1583815 390622 ~ 408312 (+)
G22420 NA other upstream 1789590 179531 ~ 189439 (+)
G23870 NA other downstream 301067 2280660 ~ 2285641 (+)

Expression

G23383 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.25.
End of interactive chart.

G23383 Expression in each Bioproject

Bar chart with 17 bars.
G23383 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network