G23770



Basic Information


Item Value
gene id G23770
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 2139288 ~ 2139544 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU26829
CTGATCCTTGCCTGTTATTTGGACTGTGTTTGTTTGCCGCCTGCCCTGACCATTGCCTGTGACTTTACTCTGCTTGTCTGCCGCCTGCCTCGACCATTGCCTGTCCCTGTTTGTGTCTCTGCCTTTGCCCCTGTCTACTCTGTAAGTACTTTTAATAAACAAGCTGCAAATGGATCCTCACGCATTCGACCCATCATTACATCCTCAGTGTGAAAAGACGGATCTCAAAATCATTCAGTCACTGTTGTAAAGGGTTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU26829 True 257 lncRNA 0.36 1 2139288 2139544
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000003_02070747_02072861 NA coding upstream 65899 2070747 ~ 2073389 (+)
CI01000003_01982406_01992219 NA coding upstream 146444 1982336 ~ 1992844 (+)
CI01000003_01969544_01973134 COPE coding upstream 166154 1969330 ~ 1973134 (+)
CI01000003_01956459_01966449 SLC25A24L coding upstream 172833 1956401 ~ 1966455 (+)
CI01000003_01921110_01928830 TXNDC12 coding upstream 209667 1920837 ~ 1929621 (+)
CI01000003_02175343_02190917 ST6GALNAC5, ST6GALNAC5A coding downstream 35246 2174790 ~ 2193320 (+)
CI01000003_02259112_02344710 AK5 coding downstream 119568 2259112 ~ 2344710 (+)
CI01000003_02422051_02446833 FAM73A, MIGA1 coding downstream 282507 2422051 ~ 2446837 (+)
CI01000003_02466819_02469433 NA coding downstream 327275 2466819 ~ 2469631 (+)
CI01000003_02510102_02514782 NA coding downstream 370558 2510102 ~ 2514969 (+)
G23356 NA non-coding upstream 91437 2029532 ~ 2047851 (+)
G23383 NA non-coding upstream 159695 1979029 ~ 1979593 (+)
G23379 NA non-coding upstream 185581 1953337 ~ 1953707 (+)
G23323 NA non-coding upstream 280074 1858488 ~ 1859214 (+)
G23322 NA non-coding upstream 281787 1855877 ~ 1857501 (+)
G23771 NA non-coding downstream 1 2139545 ~ 2139868 (+)
G23787 NA non-coding downstream 61150 2200694 ~ 2200936 (+)
G23789 NA non-coding downstream 67561 2207105 ~ 2207635 (+)
G23871 NA non-coding downstream 150802 2290346 ~ 2291021 (+)
G23893 NA non-coding downstream 314034 2453578 ~ 2454181 (+)
CI01000003_01863421_01867859 NA other upstream 271151 1862854 ~ 1868137 (+)
G22578 NA other upstream 1214040 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 1744074 390622 ~ 408312 (+)
G22420 NA other upstream 1949849 179531 ~ 189439 (+)
G23870 NA other downstream 141116 2280660 ~ 2285641 (+)

Expression


G23770 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G23770 Expression in each Bioproject

Bar chart with 22 bars.
G23770 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network