G24058



Basic Information


Item Value
gene id G24058
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 2615086 ~ 2615402 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU27165
AGGTGTCCATTAGGCTACTTGTAAATAAATCTCACAAAAACAATACCGTTATCATAGCCTACCAGTTTCTAAAAATAAAGATTTGTTTTTAAAGACAATATTCTTGTTATTCCAAATAGGCTAACAGATTTGTGTGGACACACAATCGTTGTGATAAAACTCAATTCACGGACACAACATTGCTAAAGTTTCTGCTCGCGGAAACCCTAAGCAAGGCAGTTACAGAAAGGAAATAATAAATAACTTTACCAGAAGAACCCGACTGTGTAAATTCTTGACATAAACAGTTCGCGTTTAAAGTTATTAAAGCATTTTCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU27165 True 317 lncRNA 0.36 1 2615086 2615402

Neighbor


gene id symbol gene type direction distance location
CI01000003_02551541_02556812 NA coding upstream 58250 2551541 ~ 2556836 (+)
CI01000003_02534151_02541110 NA coding upstream 73642 2534151 ~ 2541444 (+)
CI01000003_02510102_02514782 NA coding upstream 100117 2510102 ~ 2514969 (+)
CI01000003_02466819_02469433 NA coding upstream 145455 2466819 ~ 2469631 (+)
CI01000003_02422051_02446833 FAM73A, MIGA1 coding upstream 168249 2422051 ~ 2446837 (+)
CI01000003_02781537_02783192 NA coding downstream 166031 2781433 ~ 2783270 (+)
G24032 NA non-coding upstream 50660 2563909 ~ 2564426 (+)
G23927 NA non-coding upstream 114207 2500655 ~ 2500879 (+)
G23925 NA non-coding upstream 124026 2490723 ~ 2491060 (+)
G23921 NA non-coding upstream 135708 2479087 ~ 2479378 (+)
G23913 NA non-coding upstream 153987 2460834 ~ 2461099 (+)
G24083 NA non-coding downstream 40461 2655863 ~ 2656066 (+)
G24090 NA non-coding downstream 47193 2662595 ~ 2662895 (+)
G24093 NA non-coding downstream 48742 2664144 ~ 2664443 (+)
G24098 NA non-coding downstream 52192 2667594 ~ 2667860 (+)
G24120 NA non-coding downstream 92890 2708292 ~ 2708671 (+)
G23870 NA other upstream 329445 2280660 ~ 2285641 (+)
CI01000003_01863421_01867859 NA other upstream 746949 1862854 ~ 1868137 (+)
G22578 NA other upstream 1689838 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 2219872 390622 ~ 408312 (+)
G22420 NA other upstream 2425647 179531 ~ 189439 (+)

Expression


G24058 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G24058 Expression in each Bioproject

Bar chart with 41 bars.
G24058 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network