CI01000004_06805399_06814604 (CAR8, CA8)


Basic Information

Item Value
gene id CI01000004_06805399_06814604
gene name CAR8, CA8
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 6805217 ~ 6814604 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_06805399_06814604.mRNA
ATGGCAGATAATGTTATTGAGGAGGCCGATAACTACCCTGGCAAGGATGAGCTGGAATGGGGCTATGAAGAAGGTGTTGAATGGGGTCTTCTGTTTCCTGAGGCAAATGGAGAGTACCAGTCCCCCATAAACCTTAACTCTAGGGAGGCCCGCTATGACCCGCGGCTGCTGGAGGTGGGGCTTAACCCCAACTATGTAGTTTGCAGAGACTGTGAAGTCATTAACGATGGTCACACTGTGAGAATCATGCTTAAGTCCAAATCAGTTGTGACTGGGGGTCCTCTCCCCAGTGACCATGAGTATGAATTGAGCGAGGTGCGCTTCCACTGGGGAAAAGAGAACCAGAGGGGTTCTGAACACACTGTCAACTTCAAGGCTTTTCCTATGGAGCTTCATCTAATCCACTGGAACGCTACATTATTCAACAGCGTGGAGGAGGCCATGGGCAAGAACAAAGGCATTCTCATCATCGCCTTATTTGTGCAGGTTGGAAAGGAACATCTTGGGCTGAAGGCCATCACAGATGTCCTGCAGGACCTGCAGTATAAGGGAAAGACAAAAATAATTCCATGTTTTAACCCCAACACATTACTGCCTGATCCTCTCTTAAGAGATTACTGGGTGTATGAGGGCTCTTTAACCACACCGCCGTGTAGTGAGAACGTCATCTGGATTCTTTACCGTTACCCCCTTACCATCTCTCAGATGCAGATTGAGGAGTTTCGTCGTCTTAGGTCCCACATTAAAGGAGCAGAGCTTCTAGAAGGCAATGACGGGATGCTGGGGGACAACTTCAGACCCACCCAGCCCCTGAGCGACAGGGTGGTCAGGGCAGCCTTCCAGTAAAACCCCCACAGCAGGATCCATTTTAATCTGCCATGGGTAAATTTACAGGAGATTGTATTCTGTTCTTTGTTTATTCAAGCGGAGCACCCTCATTTGAGCATAATGCAATGGCTTACGTATGGCTTTGGCTGCTCTTTGTAAAGCAGGAGTTAAGATTAGGCTTCTCACATTAGCTGATTAAA

Function

symbol description
ca8 Predicted to enable hydro-lyase activity. Acts upstream of or within cerebellum development; chordate embryonic development; and swimming behavior. Is expressed in several structures, including brain; digestive system; hatching gland; hindbrain neural plate; and pleuroperitoneal region. Used to study cerebellar ataxia, mental retardation and dysequlibrium syndrome. Human ortholog(s) of this gene implicated in cerebellar ataxia, mental retardation and dysequlibrium syndrome. Orthologous to human CA8 (carbonic anhydrase 8).
car8 Predicted to enable hydro-lyase activity. Acts upstream of or within phosphatidylinositol-mediated signaling. Located in cytoplasm. Is expressed in several structures, including alimentary system; brain; ear; genitourinary system; and respiratory system. Used to study cerebellar ataxia, mental retardation and dysequlibrium syndrome. Human ortholog(s) of this gene implicated in cerebellar ataxia, mental retardation and dysequlibrium syndrome. Orthologous to human CA8 (carbonic anhydrase 8).

GO:

id name namespace
GO:0007626 locomotory behavior biological_process

KEGG:

id description
K01672 CA; carbonic anhydrase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_06805399_06814604.mRNA True 1028 mRNA 0.48 8 6805217 6814604

Neighbor

gene id symbol gene type direction distance location
CI01000004_06677179_06740196 TOX coding downstream 65021 6677179 ~ 6740196 (-)
CI01000004_06569673_06570071 NA coding downstream 235046 6569596 ~ 6570171 (-)
CI01000004_06555703_06558890 HS2ST1, HS2ST1A, HS2ST coding downstream 246327 6555477 ~ 6558890 (-)
CI01000004_06547877_06549227 NA coding downstream 255990 6547390 ~ 6549227 (-)
CI01000004_06539836_06541252 NA coding downstream 263965 6538904 ~ 6541252 (-)
CI01000004_06827636_06828127 NA coding upstream 12840 6827444 ~ 6828364 (-)
CI01000004_06915152_06921193 FBXL7 coding upstream 99985 6914589 ~ 6921193 (-)
CI01000004_06960750_06963258 MPLKIP coding upstream 146071 6959573 ~ 6963282 (-)
CI01000004_07008022_07016495 INHBAB coding upstream 193224 7007828 ~ 7017478 (-)
CI01000004_07024832_07032532 AFG3L2 coding upstream 209089 7023693 ~ 7033161 (-)
G29411 NA non-coding downstream 830 6804003 ~ 6804387 (-)
G29408 NA non-coding downstream 9596 6795322 ~ 6795621 (-)
G29402 NA non-coding downstream 34634 6770362 ~ 6770583 (-)
G29391 NA non-coding downstream 148832 6655223 ~ 6656385 (-)
G29387 NA non-coding downstream 175747 6629066 ~ 6629470 (-)
G29414 NA non-coding upstream 7363 6821967 ~ 6896950 (-)
G29351 NA non-coding upstream 57968 6872572 ~ 6875863 (-)
G29433 NA non-coding upstream 82417 6897021 ~ 6897255 (-)
G29441 NA non-coding upstream 149529 6964133 ~ 6964337 (-)
G29388 NA other downstream 173310 6631293 ~ 6631907 (-)
CI01000004_05617072_05627369 NA other downstream 1177703 5616644 ~ 5628289 (-)
G27746 NA other downstream 1601493 5178227 ~ 5203724 (-)
G26788 NA other downstream 3529496 3267683 ~ 3275721 (-)
G29656 NA other upstream 1149760 7964364 ~ 7965500 (-)
G29746 NA other upstream 1539894 8354498 ~ 8358127 (-)
G30316 NA other upstream 2563333 9377937 ~ 9406921 (-)
G31203 NA other upstream 3931833 10746437 ~ 10750641 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 4592861 11406957 ~ 11412907 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location